Home > Mutants (Isolated) > tm369

Mutants (Isolated)

Allele Name		tm369
Allele Type		Normal
Sequence Name		F48F7.1
Gene Name		alg-1
Worm Base	Allele Name	tm369
	Gene Name	alg-1
	Sequence	F48F7.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. R.H. Horvitz: sluggish, some die. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. O. Hobert: no effect on DA, DB projection patterns.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2131/2132-2936/2937 (805 bp deletion)
Chromosome		X
Putative gene structure		join(Z69663.1:30546..30755, 112..284, 431..601, 655..2117, 2173..3158)
Map position		15.1
Balancer
Map position of balancer
Sequence of primers		IntRev:GGTGGTATCCTCGGAAGTTC,ExtRev:GGCATCCGGATGAACCTAAA,ExtFwd:CCTACTCAGCCACAAACATT,IntFwd:CCTCAAAGACAAGCCGGAAG
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Alessi AF, Khivansara V, Han T, Freeberg MA, Moresco JJ, Tu PG, Montoye E, Yates JR 3rd, Karp X, Kim JK. Casein kinase II promotes target silencing by miRISC through direct phosphorylation of the DEAD-box RNA helicase CGH-1. Proc Natl Acad Sci U S A 2015 112(52) E7213-22  [ PubMed ID = 26669440 ] [ RRC reference ] Zinovyeva AY, Bouasker S, Simard MJ, Hammell CM, Ambros V. Mutations in conserved residues of the C. elegans microRNA Argonaute ALG-1 identify separable functions in ALG-1 miRISC loading and target repression. PLoS Genet 2014 10(4) e1004286  [ PubMed ID = 24763381 ] [ RRC reference ] Hammell CM, Lubin I, Boag PR, Blackwell TK, Ambros V. nhl-2 Modulates microRNA activity in Caenorhabditis elegans. Cell 2009 136(5) 926-38  [ PubMed ID = 19269369 ] [ RRC reference ]