| Allele Name | tm3686 |
| Sequence Name | C08G5.4 |
| CGC Name | snt-6 |
| Worm Base | Allele Name |
tm3686
|
| CGC Name |
snt-6
|
| Sequence |
C08G5.4
|
| Phenotype | homozygous viable. |
| Mutation site | 14581/14582-15125/15126 (544 bp deletion) |
| Chromosome | II |
| Putative gene structure | complement(join(11028..11344, 11821..11935, 11984..12153, 14516..14632, 14839..14977, 15236..15401, 15459..15556)) |
| Map position | -15.59 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntFwd:GGGTGGGATGATTATTGCTC,ExtFwd:TGCTAGAAACCTCGTCGTAC,IntRev:GGGCTTTGGAGCAAAAGGTC,ExtRev:AGTAGCGCAGCCGGTAGTAG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mullen GP, Grundahl KM, Gu M, Watanabe S, Hobson RJ, Crowell JA, McManus JR, Mathews EA, Jorgensen EM, Rand JB.
UNC-41/stonin functions with AP2 to recycle synaptic vesicles in Caenorhabditis elegans.
PLoS One 2012 7(7) e40095
[ PubMed ID = 22808098 ]
[ RRC reference ]
|
Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J Neurosci 2014 34(2) 629-45
[ PubMed ID = 24403161 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.