Mutants (Isolated)

tm3681

Allele Nametm3681
Allele TypeNormal
Sequence NameC06G1.4
Gene Nameain-1
Worm BaseAllele Name tm3681
Gene Name ain-1
Sequence C06G1.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 4952/4953-CACTTCAACATT-5724/5725 (772 bp deletion + 12 bp insertion)
ChromosomeX
Putative gene structurejoin(4029..4209, 4253..4405, 4463..5281, 5407..5498, 5543..6058, 6619..6783)
Map position24.06
Balancer
Map position of balancer
Sequence of primersIntRev:TATCCCGCCGCCCAATTTAA,IntFwd:GAGCGATGTGCAGTATCCAC,ExtRev:CATGACTTCCAGCTTGCTAG,ExtFwd:TATGGGGTGATCCACCATTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Alessi AF, Khivansara V, Han T, Freeberg MA, Moresco JJ, Tu PG, Montoye E, Yates JR 3rd, Karp X, Kim JK.
Casein kinase II promotes target silencing by miRISC through direct phosphorylation of the DEAD-box RNA helicase CGH-1.
Proc Natl Acad Sci U S A 2015 112(52) E7213-22 
[ PubMed ID = 26669440 ] [ RRC reference ]

Kogure A, Uno M, Ikeda T, Nishida E.
The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.
J Biol Chem 2017 292(27) 11300-11309 
[ PubMed ID = 28507100 ] [ RRC reference ]

Zhang X, Zabinsky R, Teng Y, Cui M, Han M.
microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause.
Proc Natl Acad Sci U S A 2011 108(44) 17997-8002 
[ PubMed ID = 22011579 ] [ RRC reference ]

Kudlow BA, Zhang L, Han M.
Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the C. elegans pathogen response.
Mol Cell 2012 46(4) 530-41 
[ PubMed ID = 22503424 ] [ RRC reference ]

Than MT, Kudlow BA, Han M.
Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation.
PLoS Genet 2013 9(6) e1003592 
[ PubMed ID = 23818874 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]