Mutants (Isolated)

tm3681

Allele Nametm3681
Sequence NameC06G1.4
CGC Nameain-1
Worm BaseAllele Name tm3681
CGC Name ain-1
Sequence C06G1.4
Phenotypehomozygous viable.
Mutation site4952/4953-CACTTCAACATT-5724/5725 (772 bp deletion + 12 bp insertion)
ChromosomeX
Putative gene structurejoin(4029..4209, 4253..4405, 4463..5281, 5407..5498, 5543..6058, 6619..6783)
Map position24.06
Balancer
Map position of balancer
Sequence of primersIntRev:TATCCCGCCGCCCAATTTAA,IntFwd:GAGCGATGTGCAGTATCCAC,ExtRev:CATGACTTCCAGCTTGCTAG,ExtFwd:TATGGGGTGATCCACCATTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kogure A, Uno M, Ikeda T, Nishida E.
The microRNA machinery regulates fasting-induced changes in gene expression and longevity in Caenorhabditis elegans.
J. Biol. Chem. 2017 292(27) 11300-11309 
[ PubMed ID = 28507100 ] [ RRC reference ]

Zhang X, Zabinsky R, Teng Y, Cui M, Han M.
microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause.
Proc. Natl. Acad. Sci. U.S.A. 2011 108(44) 17997-8002 
[ PubMed ID = 22011579 ] [ RRC reference ]

Than MT, Kudlow BA, Han M.
Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation.
PLoS Genet. 2013 9(6) e1003592 
[ PubMed ID = 23818874 ] [ RRC reference ]

Kudlow BA, Zhang L, Han M.
Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the C. elegans pathogen response.
Mol. Cell 2012 46(4) 530-41 
[ PubMed ID = 22503424 ] [ RRC reference ]

Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]