Mutants (Isolated)

tm3674

Allele Nametm3674
Sequence NameY51H4A.12
CGC Nameset-26
Worm BaseAllele Name tm3674
CGC Name set-26
Sequence Y51H4A.12
Phenotypehomozygous viable. Dr. S.S. Lee: deletion confirmed.
Mutation site181280/181281-182582/182583 (1302 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997))
Map position15.14
Balancer
Map position of balancer
Sequence of primersExtFwd:TTCACCACGATATGAGTCCT,IntFwd:CCGGCCTAATCTAGCTCCTT,ExtRev:ATGCAGCAGAGAGGGTATAG,IntRev:GGGTATAGAAGGCTTAGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ni Z, Ebata A, Alipanahiramandi E, Lee SS.
Two SET domain containing genes link epigenetic changes and aging in Caenorhabditis elegans.
Aging Cell 2012 11(2) 315-25 
[ PubMed ID = 22212395 ] [ RRC reference ]