Mutants (Isolated)

tm3671

Allele Nametm3671
Sequence NameY48A6C.5
CGC Namepha-1
Worm BaseAllele Name tm3671
CGC Name pha-1
Sequence Y48A6C.5
Phenotypelethal or sterile.
Mutation site31888/31889-32091/32092 (203 bp deletion)
ChromosomeIII
Putative gene structurejoin(31284..31331, 31944..32335, 32388..32509, 32579..32747, 34723..35467)
Map position6.14
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:CGTTGCTCGATGATTTCTCC,IntFwd:CCTTGCGAATAACATAGCAG,ExtRev:CGGTTGTCGCGCACTACTGA,IntRev:GCACTACTGAATCAGAGTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kuzmanov A, Yochem J, Fay DS.
Analysis of PHA-1 reveals a limited role in pharyngeal development and novel functions in other tissues.
Genetics 2014 198(1) 259-68 
[ PubMed ID = 25009149 ] [ RRC reference ]

Kelley M, Yochem J, Krieg M, Calixto A, Heiman MG, Kuzmanov A, Meli V, Chalfie M, Goodman MB, Shaham S, Frand A, Fay DS.
FBN-1, a fibrillin-related protein, is required for resistance of the epidermis to mechanical deformation during C. elegans embryogenesis.
Elife 2015 4  
[ PubMed ID = 25798732 ] [ RRC reference ]

Polley SR, Kuzmanov A, Kuang J, Karpel J, Lažetić V, Karina EI, Veo BL, Fay DS.
Implicating SCF complexes in organogenesis in Caenorhabditis elegans.
Genetics 2014 196(1) 211-23 
[ PubMed ID = 24214340 ] [ RRC reference ]

Mani K, Fay DS.
A mechanistic basis for the coordinated regulation of pharyngeal morphogenesis in Caenorhabditis elegans by LIN-35/Rb and UBC-18-ARI-1.
PLoS Genet. 2009 5(6) e1000510 
[ PubMed ID = 19521497 ] [ RRC reference ]

Fay DS, Polley SR, Kuang J, Kuzmanov A, Hazel JW, Mani K, Veo BL, Yochem J.
A regulatory module controlling pharyngeal development and function in Caenorhabditis elegans.
Genetics 2012 191(3) 827-43 
[ PubMed ID = 22542967 ] [ RRC reference ]