Home > Mutants (Isolated) > tm3659

Mutants (Isolated)

Allele Name		tm3659
Allele Type		Normal
Sequence Name		Y49E10.20
Gene Name		Y49E10.20
Worm Base	Allele Name	tm3659
	Gene Name	Y49E10.20
	Sequence	Y49E10.20
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		86970/86971-87664/87665 (694 bp deletion)
Chromosome		III
Putative gene structure		complement(join(86322..86411, 86465..86660, 86709..86952, 87032..87413, 87518..87646, 87943..88192, 89068..89255, 89317..89442))
Map position		17.88
Balancer
Map position of balancer
Sequence of primers		IntFwd:TTCGTCGGATTGTCGCTGTA,ExtRev:AATGGTCTCCGAGGCTCCGT,ExtFwd:CCAGCACAAGACGTCCGTAC,IntRev:GGCTCCGTATATTACGGTAT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Fang J, Wang J, Wang Y, Liu X, Chen B, Zou W. Ribo-On and Ribo-Off tools using a self-cleaving ribozyme allow manipulation of endogenous gene expression in C. elegans. Commun Biol 2023 6(1) 816  [ PubMed ID = 37542105 ] [ RRC reference ] Corrionero A, Horvitz HR. A C9orf72 ALS/FTD Ortholog Acts in Endolysosomal Degradation and Lysosomal Homeostasis. Curr Biol 2018 28(10) 1522-1535.e5  [ PubMed ID = 29731301 ] [ RRC reference ] Li Y, Chen B, Zou W, Wang X, Wu Y, Zhao D, Sun Y, Liu Y, Chen L, Miao L, Yang C, Wang X. The lysosomal membrane protein SCAV-3 maintains lysosome integrity and adult longevity. J Cell Biol 2016 215(2) 167-185  [ PubMed ID = 27810910 ] [ RRC reference ]