Mutants (Isolated)

tm3659

Allele Nametm3659
Sequence NameY49E10.20
CGC NameY49E10.20
Worm BaseAllele Name tm3659
CGC Name Y49E10.20
Sequence Y49E10.20
Phenotypehomozygous viable.
Mutation site86970/86971-87664/87665 (694 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(86322..86411, 86465..86660, 86709..86952, 87032..87413, 87518..87646, 87943..88192, 89068..89255, 89317..89442))
Map position17.88
Balancer
Map position of balancer
Sequence of primersIntFwd:TTCGTCGGATTGTCGCTGTA,ExtRev:AATGGTCTCCGAGGCTCCGT,ExtFwd:CCAGCACAAGACGTCCGTAC,IntRev:GGCTCCGTATATTACGGTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Corrionero A, Horvitz HR.
A C9orf72 ALS/FTD Ortholog Acts in Endolysosomal Degradation and Lysosomal Homeostasis.
Curr Biol 2018 28(10) 1522-1535.e5 
[ PubMed ID = 29731301 ] [ RRC reference ]

Li Y, Chen B, Zou W, Wang X, Wu Y, Zhao D, Sun Y, Liu Y, Chen L, Miao L, Yang C, Wang X.
The lysosomal membrane protein SCAV-3 maintains lysosome integrity and adult longevity.
J Cell Biol 2016 215(2) 167-185 
[ PubMed ID = 27810910 ] [ RRC reference ]