Allele Name | tm3649 |
Sequence Name | K02A2.3 |
CGC Name | kcc-3 |
Worm Base | Allele Name |
tm3649
|
CGC Name |
kcc-3
|
Sequence |
K02A2.3
|
Phenotype | lethal or sterile. |
Mutation site | 23278/23279-23932/23933 (654 bp deletion) |
Chromosome | II |
Putative gene structure | complement(join(19741..19827, 19873..20071, 20408..20658, 20735..21024, 21067..21346, 21423..21621, 21674..21793, 21924..22110, 22353..22900, 22950..23072, 23118..23551, 23600..23743, 23809..23993, 24055..24070)) |
Map position | 0.5 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:ATGCTGATACCCATGCGGGT,IntFwd:CCATGCGGGTTACCACAAAC,ExtRev:GGTGACGCAGATAAATACAG,IntRev:CTATGGGAAAAGGCGGGGGT |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Yoshida A, Nakano S, Suzuki T, Ihara K, Higashiyama T, Mori I. A glial K(+) /Cl(-) cotransporter modifies temperature-evoked dynamics in Caenorhabditis elegans sensory neurons. Genes Brain Behav 2016 15(4) 429-40
[ PubMed ID = 26463820 ]
[ RRC reference ]
|
Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S. A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC. Cell 2016 165(4) 936-48
[ PubMed ID = 27062922 ]
[ RRC reference ]
|
|