Mutants (Isolated)

tm3649

Allele Nametm3649
Sequence NameK02A2.3
CGC Namekcc-3
Worm BaseAllele Name tm3649
CGC Name kcc-3
Sequence K02A2.3
Phenotypelethal or sterile.
Mutation site23278/23279-23932/23933 (654 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(19741..19827, 19873..20071, 20408..20658, 20735..21024, 21067..21346, 21423..21621, 21674..21793, 21924..22110, 22353..22900, 22950..23072, 23118..23551, 23600..23743, 23809..23993, 24055..24070))
Map position0.5
Balancer
Map position of balancer
Sequence of primersExtFwd:ATGCTGATACCCATGCGGGT,IntFwd:CCATGCGGGTTACCACAAAC,ExtRev:GGTGACGCAGATAAATACAG,IntRev:CTATGGGAAAAGGCGGGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yoshida A, Nakano S, Suzuki T, Ihara K, Higashiyama T, Mori I.
A glial K(+) /Cl(-) cotransporter modifies temperature-evoked dynamics in Caenorhabditis elegans sensory neurons.
Genes Brain Behav 2016 15(4) 429-40 
[ PubMed ID = 26463820 ] [ RRC reference ]

Singhvi A, Liu B, Friedman CJ, Fong J, Lu Y, Huang XY, Shaham S.
A Glial K/Cl Transporter Controls Neuronal Receptive Ending Shape by Chloride Inhibition of an rGC.
Cell 2016 165(4) 936-48 
[ PubMed ID = 27062922 ] [ RRC reference ]