Mutants (Isolated)

tm3642

Allele Nametm3642
Sequence NameT20B5.3
CGC Nameoga-1
Worm BaseAllele Name tm3642
CGC Name oga-1
Sequence T20B5.3
Phenotypehomozygous viable.
Mutation site20116/20117-20551/20552 (435 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(16997..17160, 17238..17559, 17619..17883, 17941..18237, 18370..18572, 18624..18846, 18966..19113, 19162..19431, 19476..19638, 19682..19917, 20249..20398, 20508..20563, 20615..20631))
Map position1.08
Balancer
Map position of balancer
Sequence of primersIntRev:GAACGATAGGGCAGTATATC,IntFwd:CCGGCGAGATTGCATACACA,ExtRev:AACCTAGTCCCTGTCTCCAC,ExtFwd:AGTATATCTTTTCCCGGCGA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Bond MR, Ghosh SK, Wang P, Hanover JA.
Conserved nutrient sensor O-GlcNAc transferase is integral to C. elegans pathogen-specific immunity.
PLoS ONE 2014 9(12) e113231 
[ PubMed ID = 25474640 ] [ RRC reference ]