Mutants (Isolated)

tm3632

Allele Nametm3632
Sequence NameZK265.9
CGC NameZK265.9
Worm BaseAllele Name tm3632
CGC Name ZK265.9
Sequence ZK265.9
Phenotypelethal or sterile.
Mutation site16773/16774-17051/17052 (278 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(16560..16667, 16744..16929, 16977..17133, 17179..17280, 17420..17619, 17696..17765, 17814..17842))
Map position2.7
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtRev:CGCCGGACTAGTTTTCTCCA,IntRev:CGTAGTTCTACAAGAGCGTA,ExtFwd:GATAGAGCATGCGGTAGGTC,IntFwd:AGCAAACGACAGCGGCCACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Choudhary V, Ojha N, Golden A, Prinz WA.
A conserved family of proteins facilitates nascent lipid droplet budding from the ER.
J Cell Biol 2015 211(2) 261-71 
[ PubMed ID = 26504167 ] [ RRC reference ]