Home > Mutants (Isolated) > tm3631

Mutants (Isolated)

Allele Name		tm3631
Allele Type		Normal
Sequence Name		F55A4.2
Gene Name		F55A4.2
Worm Base	Allele Name	tm3631
	Gene Name	F55A4.2
	Sequence	F55A4.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12986/12987-TTCAAACTCACATCGGTAAA-13380/13381 (394 bp deletion + 20 bp insertion)
Chromosome		X
Putative gene structure		complement(join(8979..9149, 9895..10022, 11850..11987, 12220..12277, 12326..12469, 12806..12907, 12976..13341))
Map position		-18.81
Balancer
Map position of balancer
Sequence of primers		ExtFwd:GATCCTCCGGAAACACGATG,ExtRev:CCCATGCATCAAAGCTCTTG,IntFwd:ATTACCCTTCTCGCCGGCAT,IntRev:TAGTTAGATGTGCTCCGAAG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Topalidou I, Chen PA, Cooper K, Watanabe S, Jorgensen EM, Ailion M. The NCA-1 and NCA-2 Ion Channels Function Downstream of Gq and Rho To Regulate Locomotion in Caenorhabditis elegans. Genetics 2017 206(1) 265-282  [ PubMed ID = 28325749 ] [ RRC reference ] Xie L, Gao S, Alcaire SM, Aoyagi K, Wang Y, Griffin JK, Stagljar I, Nagamatsu S, Zhen M. NLF-1 delivers a sodium leak channel to regulate neuronal excitability and modulate rhythmic locomotion. Neuron 2013 77(6) 1069-82  [ PubMed ID = 23522043 ] [ RRC reference ]