Mutants (Isolated)

tm3631

Allele Nametm3631
Sequence NameF55A4.2
CGC NameF55A4.2
Worm BaseAllele Name tm3631
CGC Name F55A4.2
Sequence F55A4.2
Phenotypehomozygous viable.
Mutation site12986/12987-TTCAAACTCACATCGGTAAA-13380/13381 (394 bp deletion + 20 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(8979..9149, 9895..10022, 11850..11987, 12220..12277, 12326..12469, 12806..12907, 12976..13341))
Map position-18.81
Balancer
Map position of balancer
Sequence of primersExtFwd:GATCCTCCGGAAACACGATG,ExtRev:CCCATGCATCAAAGCTCTTG,IntFwd:ATTACCCTTCTCGCCGGCAT,IntRev:TAGTTAGATGTGCTCCGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Xie L, Gao S, Alcaire SM, Aoyagi K, Wang Y, Griffin JK, Stagljar I, Nagamatsu S, Zhen M.
NLF-1 delivers a sodium leak channel to regulate neuronal excitability and modulate rhythmic locomotion.
Neuron 2013 77(6) 1069-82 
[ PubMed ID = 23522043 ] [ RRC reference ]

Topalidou I, Chen PA, Cooper K, Watanabe S, Jorgensen EM, Ailion M.
The NCA-1 and NCA-2 Ion Channels Function Downstream of Gq and Rho To Regulate Locomotion in Caenorhabditis elegans.
Genetics 2017 206(1) 265-282 
[ PubMed ID = 28325749 ] [ RRC reference ]