Mutants (Isolated)

tm363

Allele Nametm363
Sequence NameC10F3.5
CGC Namepcm-1
Worm BaseAllele Name tm363
CGC Name pcm-1
Sequence C10F3.5
Phenotypehomozygous viable. Dr. S. Clarke: Dev. Biol. in press.
Mutation site2061/2062-3151/3152 (1090 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(183..290, 343..408, 1300..1383, 2095..2217, 2271..2375, 2556..2692, 3123..3177))
Map position-0.7
Balancer
Map position of balancer
Sequence of primersIntRev:AGCCGGAGCTAAACCTTGTT,ExtFwd:TTCTGCCACCTTCAGCCAGT,ExtRev:CGTCTGAGAGAACATCGATT,IntFwd:GTTGATCCGTGAGCTGAAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gomez TA, Banfield KL, Trogler DM, Clarke SG.
The L-isoaspartyl-O-methyltransferase in Caenorhabditis elegans larval longevity and autophagy.
Dev. Biol. 2007 303(2) 493-500 
[ PubMed ID = 17187774 ] [ RRC reference ]

Banfield KL, Gomez TA, Lee W, Clarke S, Larsen PL.
Protein-repair and hormone-signaling pathways specify dauer and adult longevity and dauer development in Caenorhabditis elegans.
J. Gerontol. A Biol. Sci. Med. Sci. 2008 63(8) 798-808 
[ PubMed ID = 18772467 ] [ RRC reference ]

Gomez TA, Banfield KL, Clarke SG.
The protein L-isoaspartyl-O-methyltransferase functions in the Caenorhabditis elegans stress response.
Mech. Ageing Dev. 2008 129(12) 752-8 
[ PubMed ID = 18977240 ] [ RRC reference ]

Khare S, Gomez T, Linster CL, Clarke SG.
Defective responses to oxidative stress in protein l-isoaspartyl repair-deficient Caenorhabditis elegans.
Mech. Ageing Dev. 2009 130(10) 670-80 
[ PubMed ID = 19682488 ] [ RRC reference ]