Mutants (Isolated)

tm3624

Allele Nametm3624
Sequence NameF43D9.4
CGC Namesip-1
Worm BaseAllele Name tm3624
CGC Name sip-1
Sequence F43D9.4
Phenotypehomozygous viable. Dr. I. Mori: weakly abnormal thermotaxis (raised at 23 C).
Mutation site18538/18539-18820/18821 (282 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(18010..18211, 18268..18545))
Map position2.91
Balancer
Map position of balancer
Sequence of primersExtRev:GAAGCGTGTCAAACGGTGTA,IntFwd:CCTGGCAGTATGTAATCTAG,IntRev:ACACTGGCGCATTTTGCGTG,ExtFwd:GACTCCCCCCTGTACCCAAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Fleckenstein T, Kastenm├╝ller A, Stein ML, Peters C, Daake M, Krause M, Weinfurtner D, Haslbeck M, Weinkauf S, Groll M, Buchner J.
The Chaperone Activity of the Developmental Small Heat Shock Protein Sip1 Is Regulated by pH-Dependent Conformational Changes.
Mol Cell 2015 58(6) 1067-78 
[ PubMed ID = 26009280 ] [ RRC reference ]