Mutants (Isolated)

tm3622

Allele Nametm3622
Sequence NameT19D7.4
CGC NameT19D7.4
Worm BaseAllele Name tm3622
CGC Name T19D7.4
Sequence T19D7.4
Phenotypehomozygous viable.
Mutation site13265/13266-13842/13843 (577 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(12251..12357, 12405..12472, 12901..13025, 13074..13385, 13451..13574, 13705..13785, 13868..14172, 14224..14460, 14504..14731, 14777..14921, 15168..15234, 15279..15384))
Map position-19.51
Balancer
Map position of balancer
Sequence of primersExtFwd:CTTGCGTGAGTCGAGATGAT,IntFwd:TTCGCTTGTTCGCGTCCTTA,ExtRev:GCGAGCGTCCGAAGATTCAA,IntRev:CGATGCATTACGGGTACAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ailion M, Hannemann M, Dalton S, Pappas A, Watanabe S, Hegermann J, Liu Q, Han HF, Gu M, Goulding MQ, Sasidharan N, Schuske K, Hullett P, Eimer S, Jorgensen EM.
Two Rab2 interactors regulate dense-core vesicle maturation.
Neuron 2014 82(1) 167-80 
[ PubMed ID = 24698274 ] [ RRC reference ]

Topalidou I, Chen PA, Cooper K, Watanabe S, Jorgensen EM, Ailion M.
The NCA-1 and NCA-2 Ion Channels Function Downstream of Gq and Rho To Regulate Locomotion in Caenorhabditis elegans.
Genetics 2017 206(1) 265-282 
[ PubMed ID = 28325749 ] [ RRC reference ]

Topalidou I, Cattin-Ortolá J, Pappas AL, Cooper K, Merrihew GE, MacCoss MJ, Ailion M.
The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles.
PLoS Genet. 2016 12(5) e1006074 
[ PubMed ID = 27191843 ] [ RRC reference ]