Home > Mutants (Isolated) > tm3622

Mutants (Isolated)

Allele Name		tm3622
Allele Type		Normal
Sequence Name		T19D7.4
Gene Name		T19D7.4
Worm Base	Allele Name	tm3622
	Gene Name	T19D7.4
	Sequence	T19D7.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13265/13266-13842/13843 (577 bp deletion)
Chromosome		X
Putative gene structure		complement(join(12251..12357, 12405..12472, 12901..13025, 13074..13385, 13451..13574, 13705..13785, 13868..14172, 14224..14460, 14504..14731, 14777..14921, 15168..15234, 15279..15384))
Map position		-19.51
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CTTGCGTGAGTCGAGATGAT,IntFwd:TTCGCTTGTTCGCGTCCTTA,ExtRev:GCGAGCGTCCGAAGATTCAA,IntRev:CGATGCATTACGGGTACAAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Yoshida K, Suehiro Y, Dejima K, Yoshina S, Mitani S. Distinct pathways for export of silencing RNA in Caenorhabditis elegans systemic RNAi. iScience 2023 26(10) 108067  [ PubMed ID = 37854694 ] [ RRC reference ] Topalidou I, Cattin-Ortolá J, Pappas AL, Cooper K, Merrihew GE, MacCoss MJ, Ailion M. The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles. PLoS Genet 2016 12(5) e1006074  [ PubMed ID = 27191843 ] [ RRC reference ] Topalidou I, Chen PA, Cooper K, Watanabe S, Jorgensen EM, Ailion M. The NCA-1 and NCA-2 Ion Channels Function Downstream of Gq and Rho To Regulate Locomotion in Caenorhabditis elegans. Genetics 2017 206(1) 265-282  [ PubMed ID = 28325749 ] [ RRC reference ] Ailion M, Hannemann M, Dalton S, Pappas A, Watanabe S, Hegermann J, Liu Q, Han HF, Gu M, Goulding MQ, Sasidharan N, Schuske K, Hullett P, Eimer S, Jorgensen EM. Two Rab2 interactors regulate dense-core vesicle maturation. Neuron 2014 82(1) 167-80  [ PubMed ID = 24698274 ] [ RRC reference ]