Mutants (Isolated)

tm3620

Allele Nametm3620
Sequence NameZK75.1
CGC Nameins-4
Worm BaseAllele Name tm3620
CGC Name ins-4
Sequence ZK75.1
Phenotypehomozygous viable. Dr. Q.L. Ch'ng: non-Unc, non-Pvl, non-Lon, non-Sma, non-Dpy.
Mutation site17584/17585-17737/17738 (153 bp deletion)
ChromosomeII
Putative gene structurejoin(17500..17734, 17793..17878)
Map position-0.73
Balancer
Map position of balancer
Sequence of primersExtRev:GATGGCTTGTTGGACGACTG,IntRev:GAGTGCACTGTGTTGTGCAG,ExtFwd:CCGCCCAATCCCTTTAACGT,IntFwd:TGGCGCTTGACGCATCAGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kaplan REW, Maxwell CS, Codd NK, Baugh LR.
Pervasive Positive and Negative Feedback Regulation of Insulin-Like Signaling in Caenorhabditis elegans.
Genetics 2019 211(1) 349-361 
[ PubMed ID = 30425043 ] [ RRC reference ]

Baugh LR, Kurhanewicz N, Sternberg PW.
Sensitive and precise quantification of insulin-like mRNA expression in Caenorhabditis elegans.
PLoS One 2011 6(3) e18086 
[ PubMed ID = 21445366 ] [ RRC reference ]

Schiffer JA, Servello FA, Heath WR, Amrit FRG, Stumbur SV, Eder M, Martin OM, Johnsen SB, Stanley JA, Tam H, Brennan SJ, McGowan NG, Vogelaar AL, Xu Y, Serkin WT, Ghazi A, Stroustrup N, Apfeld J.
Caenorhabditis elegans processes sensory information to choose between freeloading and self-defense strategies.
Elife 2020 9  
[ PubMed ID = 32367802 ] [ RRC reference ]

Ryu L, Cheon Y, Huh YH, Pyo S, Chinta S, Choi H, Butcher RA, Kim K.
Feeding state regulates pheromone-mediated avoidance behavior via the insulin signaling pathway in Caenorhabditis elegans.
EMBO J 2018 37(15)  
[ PubMed ID = 29925517 ] [ RRC reference ]

Wu T, Duan F, Yang W, Liu H, Caballero A, Fernandes de Abreu DA, Dar AR, Alcedo J, Ch'ng Q, Butcher RA, Zhang Y.
Pheromones Modulate Learning by Regulating the Balanced Signals of Two Insulin-like Peptides.
Neuron 2019 104(6) 1095-1109.e5 
[ PubMed ID = 31676170 ] [ RRC reference ]

Lee D, Lee H, Kim N, Lim DS, Lee J.
Regulation of a hitchhiking behavior by neuronal insulin and TGF-β signaling in the nematode Caenorhabditis elegans.
Biochem Biophys Res Commun 2017 484(2) 323-330 
[ PubMed ID = 28131836 ] [ RRC reference ]

Chen Y, Baugh LR.
Ins-4 and daf-28 function redundantly to regulate C. elegans L1 arrest.
Dev Biol 2014 394(2) 314-26 
[ PubMed ID = 25128585 ] [ RRC reference ]

Hung WL, Wang Y, Chitturi J, Zhen M.
A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication.
Development 2014 141(8) 1767-79 
[ PubMed ID = 24671950 ] [ RRC reference ]

Fernandes de Abreu DA, Caballero A, Fardel P, Stroustrup N, Chen Z, Lee K, Keyes WD, Nash ZM, López-Moyado IF, Vaggi F, Cornils A, Regenass M, Neagu A, Ostojic I, Liu C, Cho Y, Sifoglu D, Shen Y, Fontana W, Lu H, Csikasz-Nagy A, Murphy CT, Antebi A, Blanc E, Apfeld J, Zhang Y, Alcedo J, Ch'ng Q.
An insulin-to-insulin regulatory network orchestrates phenotypic specificity in development and physiology.
PLoS Genet 2014 10(3) e1004225 
[ PubMed ID = 24675767 ] [ RRC reference ]