Mutants (Isolated)

tm361

Allele Nametm361
Sequence NameC18A3.5
CGC NameC18A3.5
Worm BaseAllele Name tm361
CGC Name C18A3.5
Sequence C18A3.5
Phenotypehomozygous viable. Dr. T. Schedl: no germline phenotype. Dr. H. Zhang: fertile and normal locomotion.
Mutation site12290/12291-12869/12870 (579 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(11415..11699, 11746..11930, 12009..12429, 12637..12732, 12870..12931, 13011..13165, 13238..13380))
Map position-0.96
Balancer
Map position of balancer
Sequence of primersIntRev:GTACTAGACGTCCAGTTCTT,ExtFwd:GGGTGGAACTTGGAATTAAG,ExtRev:GCTAGGAATTTTGGCGATAG,IntFwd:GGGCAATAGGGTCACATATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huelgas-Morales G, Silva-García CG, Salinas LS, Greenstein D, Navarro RE.
The Stress Granule RNA-Binding Protein TIAR-1 Protects Female Germ Cells from Heat Shock in Caenorhabditis elegans.
G3 (Bethesda) 2016 6(4) 1031-47 
[ PubMed ID = 26865701 ] [ RRC reference ]

Silva-García CG, Estela Navarro R.
The C. elegans TIA-1/TIAR homolog TIAR-1 is required to induce germ cell apoptosis.
Genesis 2013 51(10) 690-707 
[ PubMed ID = 23913578 ] [ RRC reference ]

Rousakis A, Vlanti A, Borbolis F, Roumelioti F, Kapetanou M, Syntichaki P.
Diverse functions of mRNA metabolism factors in stress defense and aging of Caenorhabditis elegans.
PLoS One 2014 9(7) e103365 
[ PubMed ID = 25061667 ] [ RRC reference ]