Mutants (Isolated)

tm3581

Allele Nametm3581
Sequence NameF32H2.6
CGC NameF32H2.6
Worm BaseAllele Name tm3581
CGC Name F32H2.6
Sequence F32H2.6
Phenotypehomozygous viable.
Mutation site39778/39779-39982/39983 (204 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(39409..39665, 39853..40094, 40302..40366))
Map position3.38
Balancer
Map position of balancer
Sequence of primersExtFwd:CTCAGGGTCCCGATATTAAC,ExtRev:GAGCTAGATGTCATCGGACT,IntFwd:GATCTTGTCGGCCGAATGAG,IntRev:GTTCGGTGGCATGCTTCTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee KZ, Kniazeva M, Han M, Pujol N, Ewbank JJ.
The fatty acid synthase fasn-1 acts upstream of WNK and Ste20/GCK-VI kinases to modulate antimicrobial peptide expression in C. elegans epidermis.
Virulence 2010 1(3) 113-22 
[ PubMed ID = 21178429 ] [ RRC reference ]