Mutants (Isolated)

tm3572

Allele Nametm3572
Sequence NameE03D2.2
CGC Namenlp-9
Worm BaseAllele Name tm3572
CGC Name nlp-9
Sequence E03D2.2
Phenotypehomozygous viable.
Mutation site1749/1750-TT-1859/1860 (110 bp deletion + 2 bp insertion)
ChromosomeV
Putative gene structurejoin(1058..1112, 1757..1817, 1866..2018, 2069..2128, 3230..3290)
Map position-6.19
Balancer
Map position of balancer
Sequence of primersIntFwd:AGATGTGTGGTCTCCGCTAA,ExtRev:TCTGTTATCCGGCAACGTCA,IntRev:TACTTACCGTTCCAAGTACG,ExtFwd:CGCTGCATCTCTTGACTTAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Clark T, Hapiak V, Oakes M, Mills H, Komuniecki R.
Monoamines differentially modulate neuropeptide release from distinct sites within a single neuron pair.
PLoS One 2018 13(5) e0196954 
[ PubMed ID = 29723289 ] [ RRC reference ]

Harris G, Shen Y, Ha H, Donato A, Wallis S, Zhang X, Zhang Y.
Dissecting the signaling mechanisms underlying recognition and preference of food odors.
J Neurosci 2014 34(28) 9389-403 
[ PubMed ID = 25009271 ] [ RRC reference ]

Mills H, Wragg R, Hapiak V, Castelletto M, Zahratka J, Harris G, Summers P, Korchnak A, Law W, Bamber B, Komuniecki R.
Monoamines and neuropeptides interact to inhibit aversive behaviour in Caenorhabditis elegans.
EMBO J 2012 31(3) 667-78 
[ PubMed ID = 22124329 ] [ RRC reference ]

Hapiak V, Summers P, Ortega A, Law WJ, Stein A, Komuniecki R.
Neuropeptides amplify and focus the monoaminergic inhibition of nociception in Caenorhabditis elegans.
J Neurosci 2013 33(35) 14107-16 
[ PubMed ID = 23986246 ] [ RRC reference ]

Stawicki TM, Takayanagi-Kiya S, Zhou K, Jin Y.
Neuropeptides function in a homeostatic manner to modulate excitation-inhibition imbalance in C. elegans.
PLoS Genet 2013 9(5) e1003472 
[ PubMed ID = 23658528 ] [ RRC reference ]