Mutants (Isolated)

tm3555

Allele Nametm3555
Sequence NameB0513.3
CGC Namerpl-29
Worm BaseAllele Name tm3555
CGC Name rpl-29
Sequence B0513.3
Phenotypehomozygous viable.
Mutation site31857/31858-GTTGTCGTTATTTTATGCCAGTTCTAGTCGAACAAATTTCAATTATTCG-32232/32233 (375 bp deletion + 49 bp insertion)
ChromosomeIV
Putative gene structurejoin(31853..31889, 32044..32195)
Map position10.9
Balancer
Map position of balancer
Sequence of primersExtRev:ATATTCTGCACGGCGCATAC,IntFwd:TATCCGCCAGCCGCGTTCTT,ExtFwd:GAGTGTGACCGTATCCGCCA,IntRev:CGGCGCATACTTCTACCAAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Noma K, Goncharov A, Ellisman MH, Jin Y.
Microtubule-dependent ribosome localization in C. elegans neurons.
Elife 2017 6  
[ PubMed ID = 28767038 ] [ RRC reference ]