Mutants (Isolated)

tm3546

Allele Nametm3546
Sequence NameY54G2A.31
CGC Nameubc-13
Worm BaseAllele Name tm3546
CGC Name ubc-13
Sequence Y54G2A.31
Phenotypehomozygous viable. Dr. Y. Jin: no movement defects, grow well.
Mutation site174972/174973-175206/175207 (234 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(172802..172809, 173983..174150, 175190..175469))
Map position-6.72
Balancer
Map position of balancer
Sequence of primersExtRev:TCTTGCAGAATGGCCGGGCA,IntRev:GGGCAACTTCCGCGTCGAAT,ExtFwd:GACAGAAGAACCGTGCGAAT,IntFwd:AGCCGGCGACCATTTATCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Sato M, Konuma R, Sato K, Tomura K, Sato K.
Fertilization-induced K63-linked ubiquitylation mediates clearance of maternal membrane proteins.
Development 2014 141(6) 1324-31 
[ PubMed ID = 24595290 ] [ RRC reference ]

Liu J, Li M, Li L, Chen S, Wang X.
Ubiquitination of the PI3-kinase VPS-34 promotes VPS-34 stability and phagosome maturation.
J. Cell Biol. 2018 217(1) 347-360 
[ PubMed ID = 29092895 ] [ RRC reference ]

Kramer LB, Shim J, Previtera ML, Isack NR, Lee MC, Firestein BL, Rongo C.
UEV-1 is an ubiquitin-conjugating enzyme variant that regulates glutamate receptor trafficking in C. elegans neurons.
PLoS ONE 2010 5(12) e14291 
[ PubMed ID = 21179194 ] [ RRC reference ]