Home > Mutants (Isolated) > tm3539

Mutants (Isolated)

Allele Name		tm3539
Balance		Not Required
OutCross		Not Accepted
Sequence Name		Y43F8B.19
Gene Name		Y43F8B.19
Worm Base	Allele Name	tm3539
	Gene Name	Y43F8B.19
	Sequence	Y43F8B.19
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		59646/59647-60569/60570 (923 bp deletion)
Chromosome		V
Putative gene structure		complement(join(59132..59205, 59257..59653, 60260..60286))
Map position		22.08
Balancer
Map position of balancer
Sequence of primers		IntRev:GCTCCACAAGCACCTTTTGA,IntFwd:CCTGGGTTCCGTTGGCTCTT,ExtRev:AGACTAGTCTGCTACCGGCT,ExtFwd:GTGATCCTCATGGAAGACCT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Torpe N, Pocock R. Regulation of axonal midline guidance by prolyl 4-hydroxylation in Caenorhabditis elegans. J Neurosci 2014 34(49) 16348-57  [ PubMed ID = 25471573 ] [ RRC reference ]