Mutants (Isolated)

tm3538

Allele Nametm3538
Sequence NameY95B8A.11
CGC NameY95B8A.11
Worm BaseAllele Name tm3538
CGC Name Y95B8A.11
Sequence Y95B8A.11
Phenotypehomozygous viable. Dr. M. Jantsch: Emb, Him.
Mutation site47520/47521-47812/47813 (292 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(45342..45416, 45520..45589, 45847..45921, 46732..46811, 47014..47112, 47591..47684, 47837..47916, 47974..48156, 49837..50039, 50092..50264, 50334..50509))
Map position-17.91
Balancer
Map position of balancer
Sequence of primersExtFwd:ACAATCGCCCCCGTGTACTC,ExtRev:ATACGCAGAACGCCGTGAAC,IntFwd:ACGCGCCGTAAATCTACGAA,IntRev:ACGCCGTGAACGCTGCAAGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Mohammad A, Vanden Broek K, Wang C, Daryabeigi A, Jantsch V, Hansen D, Schedl T.
Initiation of Meiotic Development Is Controlled by Three Post-transcriptional Pathways in Caenorhabditis elegans.
Genetics 2018 209(4) 1197-1224 
[ PubMed ID = 29941619 ] [ RRC reference ]

Tang L, Machacek T, Mamnun YM, Penkner A, Gloggnitzer J, Wegrostek C, Konrat R, Jantsch MF, Loidl J, Jantsch V.
Mutations in Caenorhabditis elegans him-19 show meiotic defects that worsen with age.
Mol Biol Cell 2010 21(6) 885-96 
[ PubMed ID = 20071466 ] [ RRC reference ]