| Allele Name | tm3538 |
| Sequence Name | Y95B8A.11 |
| CGC Name | Y95B8A.11 |
| Worm Base | Allele Name |
tm3538
|
| CGC Name |
Y95B8A.11
|
| Sequence |
Y95B8A.11
|
| Phenotype | homozygous viable. Dr. M. Jantsch: Emb, Him. |
| Mutation site | 47520/47521-47812/47813 (292 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(45342..45416, 45520..45589, 45847..45921, 46732..46811, 47014..47112, 47591..47684, 47837..47916, 47974..48156, 49837..50039, 50092..50264, 50334..50509)) |
| Map position | -17.91 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:ACAATCGCCCCCGTGTACTC,ExtRev:ATACGCAGAACGCCGTGAAC,IntFwd:ACGCGCCGTAAATCTACGAA,IntRev:ACGCCGTGAACGCTGCAAGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Mohammad A, Vanden Broek K, Wang C, Daryabeigi A, Jantsch V, Hansen D, Schedl T.
Initiation of Meiotic Development Is Controlled by Three Post-transcriptional Pathways in Caenorhabditis elegans.
Genetics 2018 209(4) 1197-1224
[ PubMed ID = 29941619 ]
[ RRC reference ]
|
Tang L, Machacek T, Mamnun YM, Penkner A, Gloggnitzer J, Wegrostek C, Konrat R, Jantsch MF, Loidl J, Jantsch V.
Mutations in Caenorhabditis elegans him-19 show meiotic defects that worsen with age.
Mol Biol Cell 2010 21(6) 885-96
[ PubMed ID = 20071466 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.