Mutants (Isolated)

tm3532

Allele Nametm3532
Sequence NameY47D7A.1
CGC Nameskr-7
Worm BaseAllele Name tm3532
CGC Name skr-7
Sequence Y47D7A.1
Phenotypehomozygous viable. Dr. H. Sawa: not Psa. Dr. R.H.Waterston: additional gut cells.
Mutation site13428/13429-13969/13970 (541 bp deletion)
ChromosomeV
Putative gene structure13145..13729
Map position-5.61
Balancer
Map position of balancer
Sequence of primersIntFwd:CGCGAGCAGTCGCAATTTAT,ExtFwd:CGTTTGGCTCTCATCGCGAG,IntRev:GCATAAGGCGGGCAGGTTTC,ExtRev:CTATGCGAAAGGCCGGCATA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Weaver BP, Zabinsky R, Weaver YM, Lee ES, Xue D, Han M.
CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in C. elegans.
Elife 2014 3 e04265 
[ PubMed ID = 25432023 ] [ RRC reference ]