Mutants (Isolated)

tm353

Allele Nametm353
Sequence NameC05D9.3
CGC NameC05D9.3
Worm BaseAllele Name tm353
CGC Name C05D9.3
Sequence C05D9.3
Phenotypehomozygous viable. Dr. Y. Jin: Development 130, 3147-3161, 2003.
Mutation site12323/12324-TTT-13123/13124 (800 deletion + 3 bp insertion)
ChromosomeX
Putative gene structurejoin(10898..11044, 11705..11812, 11931..12015, 12076..12217, 12263..12326, 13395..13543, 14210..14282, 14964..15014, 15071..15160, 15233..15442)
Map position-18.56
Balancer
Map position of balancer
Sequence of primersExtRev:TTCAGTGGCTTCTGGCTCCT,IntFwd:CCCGAGACTATGGAAATTCA,ExtFwd:CAAGCAGACGGAGCACCGAA,IntRev:CTGGCTTATCCTTCTCCTCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang X, Huang P, Robinson MK, Stern MJ, Jin Y.
UNC-71, a disintegrin and metalloprotease (ADAM) protein, regulates motor axon guidance and sex myoblast migration in C. elegans.
Development 2003 130(14) 3147-61 
[ PubMed ID = 12783787 ] [ RRC reference ]