Mutants (Isolated)

tm3526

Allele Nametm3526
Sequence NameY51H4A.12
CGC Nameset-26
Worm BaseAllele Name tm3526
CGC Name set-26
Sequence Y51H4A.12
Phenotypehomozygous viable. Dr. S.S. Lee: deletion confirmed.
Mutation site179494/179495-179851/179852 (357 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(175289..175332, 175464..175728, 176384..177177, 177711..177984, 178467..180302, 181241..182147, 183042..183382, 183470..183840, 183892..183997))
Map position15.14
Balancer
Map position of balancer
Sequence of primersExtFwd:AAGACGAGACCCTGGCAATG,IntFwd:TCGAATCGAAACCACGCCAG,ExtRev:CCGCCGAACTTCCTCCTCAA,IntRev:AAGCCTCCGACGCTCCTCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kalinava N, Ni JZ, Peterman K, Chen E, Gu SG.
Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.
Epigenetics Chromatin 2017 10 6 
[ PubMed ID = 28228846 ] [ RRC reference ]

Greer EL, Beese-Sims SE, Brookes E, Spadafora R, Zhu Y, Rothbart SB, Aristiz√°bal-Corrales D, Chen S, Badeaux AI, Jin Q, Wang W, Strahl BD, Colai√°covo MP, Shi Y.
A histone methylation network regulates transgenerational epigenetic memory in C. elegans.
Cell Rep 2014 7(1) 113-26 
[ PubMed ID = 24685137 ] [ RRC reference ]