Mutants (Isolated)

tm3516

Allele Nametm3516
Sequence NameB0205.6
CGC NameB0205.6
Worm BaseAllele Name tm3516
CGC Name B0205.6
Sequence B0205.6
Phenotypelethal or sterile.
Mutation site31989/31990-32497/32498 (508 bp deletion)
ChromosomeI
Putative gene structurejoin(30775..30843, 31349..31486, 31531..31650, 31823..31921, 31967..32060, 32213..32347, 32398..32553, 33014..33154, 33464..33630, 33681..33800)
Map position5.07
BalancerhT2 [qIs48]
Map position of balancer
Sequence of primersExtFwd:AGTCGACGCAATGCTTCCCT,IntFwd:ACGCAATGCTTCCCTATATG,ExtRev:ACCATACCCATCTCCTTATC,IntRev:GTCCAATGCACAATGGAGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ast T, Meisel JD, Patra S, Wang H, Grange RMH, Kim SH, Calvo SE, Orefice LL, Nagashima F, Ichinose F, Zapol WM, Ruvkun G, Barondeau DP, Mootha VK.
Hypoxia Rescues Frataxin Loss by Restoring Iron Sulfur Cluster Biogenesis.
Cell 2019 177(6) 1507-1521.e16 
[ PubMed ID = 31031004 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]