Mutants (Isolated)

tm3515

Allele Nametm3515
Sequence NameT01E8.9
CGC Nameubxn-5
Worm BaseAllele Name tm3515
CGC Name ubxn-5
Sequence T01E8.9
Phenotypehomozygous viable.
Mutation site26235/26236-26520/26521 (285 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(26026..26354, 26403..26532, 26573..26638))
Map position2.32
Balancer
Map position of balancer
Sequence of primersExtFwd:AACCTACCTGCCTCACGTCA,ExtRev:GGACGAAGATACGTGCATCC,IntFwd:CTCACGTCACCCAAAGGCAT,IntRev:TCTTTATCATCCGGGAACCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rodrigues AJ, Neves-Carvalho A, Ferro A, Rokka A, Corthals G, Logarinho E, Maciel P.
ATX-3, CDC-48 and UBXN-5: a new trimolecular complex in Caenorhabditis elegans.
Biochem. Biophys. Res. Commun. 2009 386(4) 575-81 
[ PubMed ID = 19545544 ] [ RRC reference ]