Mutants (Isolated)

tm3510

Allele Nametm3510
Allele TypeBalanced
Sequence NameF21C3.5
Gene Namepfd-6
Worm BaseAllele Name tm3510
Gene Name pfd-6
Sequence F21C3.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 19979/19980-20340/20341 (361 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(19978..20104, 20243..20367, 20413..20483, 20531..20588))
Map position1.87
BalancerhT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersIntRev:AACCTAGGGAAATACCCTGA,ExtRev:ACGCTGCTGGAGACCGACTT,IntFwd:TAGACGTGAGCACAAATGGT,ExtFwd:ATACGACGATGATGGCTGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Son HG, Seo K, Seo M, Park S, Ham S, An SWA, Choi ES, Lee Y, Baek H, Kim E, Ryu Y, Ha CM, Hsu AL, Roh TY, Jang SK, Lee SV.
Prefoldin 6 mediates longevity response from heat shock factor 1 to FOXO in C. elegans.
Genes Dev 2018 32(23-24) 1562-1575 
[ PubMed ID = 30478249 ] [ RRC reference ]