Mutants (Isolated)

tm349

Allele Nametm349
Sequence NameB0350.2
CGC Nameunc-44
Worm BaseAllele Name tm349
CGC Name unc-44
Sequence B0350.2
PhenotypeLet or Ste.
Mutation site25508/25509-26167/26168 (659 bp deletion)
ChromosomeIV
Putative gene structurea.1=join(21831..22631, 22795..22944, 23506..23757) ; b.1=join(17346..17698, 18711..18843, 18890..20732, 20844..21021, 21072..21256, 21369..21657); c.1=join(2932..3039, 11833..12142, 12528..13021, 13876..14693, 15050..15691, 15865..15977, 16147..16437, 17346..17698, 18711..18843, 18890..20732, 20844..21021, 21072..21256, 21369..21446, 22795..22944, 23506..23747)
Map position2.91
BalancernT1
Map position of balancer
Sequence of primersIntRev:TTCCGATTCAACATGGGATG,ExtFwd:GGAATGTCGAGTCTGCTTAT,IntFwd:GTTGAAACCGATCGCCGTGA,ExtRev:GAGACTCAAGAACCTGACGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen F, Chisholm AD, Jin Y.
Tissue-specific regulation of alternative polyadenylation represses expression of a neuronal ankyrin isoform in C. elegans epidermal development.
Development 2017 144(4) 698-707 
[ PubMed ID = 28087624 ] [ RRC reference ]

Chen F, Zhou Y, Qi YB, Khivansara V, Li H, Chun SY, Kim JK, Fu XD, Jin Y.
Context-dependent modulation of Pol II CTD phosphatase SSUP-72 regulates alternative polyadenylation in neuronal development.
Genes Dev 2015 29(22) 2377-90 
[ PubMed ID = 26588990 ] [ RRC reference ]