Mutants (Isolated)

tm3489

Allele Nametm3489
Sequence NameC32D5.9
CGC Namelgg-1
Worm BaseAllele Name tm3489
CGC Name lgg-1
Sequence C32D5.9
Phenotypelethal or sterile. Dr. K. Sato: Science 334, 1141 (2011)
Mutation site35389/35390-35564/35565 (175 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(35252..35335, 35388..35675))
Map position-0.38
BalancermIn1
Map position of balancer
Sequence of primersIntRev:GGTCAATCTCTCAAAACCCA,ExtFwd:CGCTGGCCGAAAATAACGAT,ExtRev:GCCTTACTAGTACTCGTCGT,IntFwd:TGGGAGGGGAGAAGAGCAAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chang JT, Kumsta C, Hellman AB, Adams LM, Hansen M.
Spatiotemporal regulation of autophagy during Caenorhabditis elegans aging.
Elife 2017 6  
[ PubMed ID = 28675140 ] [ RRC reference ]

Jenzer C, Simionato E, Legouis R.
Tools and methods to analyze autophagy in C. elegans.
Methods 2015 75 162-71 
[ PubMed ID = 25484340 ] [ RRC reference ]

Manil-Ségalen M, Culetto E, Legouis R, Lefebvre C.
Interactions between endosomal maturation and autophagy: analysis of ESCRT machinery during Caenorhabditis elegans development.
Meth. Enzymol. 2014 534 93-118 
[ PubMed ID = 24359950 ] [ RRC reference ]

Al Rawi S, Louvet-Vallée S, Djeddi A, Sachse M, Culetto E, Hajjar C, Boyd L, Legouis R, Galy V.
Postfertilization autophagy of sperm organelles prevents paternal mitochondrial DNA transmission.
Science 2011 334(6059) 1144-7 
[ PubMed ID = 22033522 ] [ RRC reference ]

Sato M, Sato K.
Degradation of paternal mitochondria by fertilization-triggered autophagy in C. elegans embryos.
Science 2011 334(6059) 1141-4 
[ PubMed ID = 21998252 ] [ RRC reference ]

Alberti A, Michelet X, Djeddi A, Legouis R.
The autophagosomal protein LGG-2 acts synergistically with LGG-1 in dauer formation and longevity in C. elegans.
Autophagy 2010 6(5) 622-33 
[ PubMed ID = 20523114 ] [ RRC reference ]

Jenzer C, Manil-Ségalen M, Lefebvre C, Largeau C, Glatigny A, Legouis R.
Human GABARAP can restore autophagosome biogenesis in a C. elegans lgg-1 mutant.
Autophagy 2014 10(10) 1868-72 
[ PubMed ID = 25126728 ] [ RRC reference ]

Djeddi A, Al Rawi S, Deuve JL, Perrois C, Liu YY, Russeau M, Sachse M, Galy V.
Sperm-inherited organelle clearance in C. elegans relies on LC3-dependent autophagosome targeting to the pericentrosomal area.
Development 2015 142(9) 1705-16 
[ PubMed ID = 25922527 ] [ RRC reference ]

Erdélyi P, Borsos E, Takács-Vellai K, Kovács T, Kovács AL, Sigmond T, Hargitai B, Pásztor L, Sengupta T, Dengg M, Pécsi I, Tóth J, Nilsen H, Vértessy BG, Vellai T.
Shared developmental roles and transcriptional control of autophagy and apoptosis in Caenorhabditis elegans.
J. Cell. Sci. 2011 124(Pt 9) 1510-8 
[ PubMed ID = 21502138 ] [ RRC reference ]

Manil-Ségalen M, Lefebvre C, Jenzer C, Trichet M, Boulogne C, Satiat-Jeunemaitre B, Legouis R.
The C. elegans LC3 acts downstream of GABARAP to degrade autophagosomes by interacting with the HOPS subunit VPS39.
Dev. Cell 2014 28(1) 43-55 
[ PubMed ID = 24374177 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev. Biol. 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]