Mutants (Isolated)

tm3480

Allele Nametm3480
Sequence NameT23F11.1
CGC NameT23F11.1
Worm BaseAllele Name tm3480
CGC Name T23F11.1
Sequence T23F11.1
Phenotypehomozygous viable.
Mutation site5713/5714-6305/6306 (592 bp deletion)
ChromosomeIII
Putative gene structurejoin(5050..5152, 5475..5765, 6317..6541, 6590..6735, 6786..6860, 7239..7322, 7536..7605, 7660..7736)
Map position-2.98
Balancer
Map position of balancer
Sequence of primersExtFwd:TCAGACAGAACTCCTTAGCT,ExtRev:TGTCCATGAAGAAGTCCCAC,IntFwd:TCAGACATGGAAGATGCCCA,IntRev:CTTAGTAGGTCTCACCACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Baker ST, Opperman KJ, Tulgren ED, Turgeon SM, Bienvenut W, Grill B.
RPM-1 uses both ubiquitin ligase and phosphatase-based mechanisms to regulate DLK-1 during neuronal development.
PLoS Genet. 2014 10(5) e1004297 
[ PubMed ID = 24810406 ] [ RRC reference ]

Tang H, Han M.
Fatty Acids Regulate Germline Sex Determination through ACS-4-Dependent Myristoylation.
Cell 2017 169(3) 457-469.e13 
[ PubMed ID = 28431246 ] [ RRC reference ]