Mutants (Isolated)

tm348

Allele Nametm348
Sequence NameC05C8.3
CGC Namefkb-3
Worm BaseAllele Name tm348
CGC Name fkb-3
Sequence C05C8.3
Phenotypehomozygous viable. Dr. WB Derry: WT morphology. Dr. A.P. Page: J. Biol. Chem. 282, 12813 (2007).
Mutation site225/226-1712/1713 (1487 deletion)
ChromosomeV
Putative gene structurejoin(1353..1709, 1785..2213)
Map position0.64
Balancer
Map position of balancer
Sequence of primersExtFwd:AAATGACTCCAAGAGCTCCA,ExtRev:CAGCTTCTCCGACCTACCAT,IntFwd:CCATCTGTTATATGTCCGCA,IntRev:TGGCATCGAGCTCAAGATAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Winter AD, Eschenlauer SC, McCormack G, Page AP.
Loss of secretory pathway FK506-binding proteins results in cold-sensitive lethality and associate extracellular matrix defects in the nematode Caenorhabditis elegans.
J. Biol. Chem. 2007 282(17) 12813-21 
[ PubMed ID = 17339317 ] [ RRC reference ]