Allele Name | tm3468 |
Sequence Name | F42H11.2 |
CGC Name | lem-3 |
Worm Base | Allele Name |
tm3468
|
CGC Name |
lem-3
|
Sequence |
F42H11.2
|
Phenotype | homozygous viable. Dr.M. Hengartner: increased embryonic lethality after X-irradiation. |
Mutation site | 3525/3526-[K07A1]238/239 (330 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(1751..1880, 1931..2007, 2053..2138, 2187..2556, 2620..2703, 2747..3722, Z81097.1:106..252, Z81097.1:306..480, Z81097.1:531..684)) |
Map position | 3.81 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntFwd:CCGGTGAATATCCACGGTTC,ExtFwd:CAACGTCAGCATCCGGTGAA,ExtRev:TGCCGCCATCTGTCTGTCTG,IntRev:CATCTCCGCAGTGAAACTTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Hong Y, Velkova M, Silva N, Jagut M, Scheidt V, Labib K, Jantsch V, Gartner A. The conserved LEM-3/Ankle1 nuclease is involved in the combinatorial regulation of meiotic recombination repair and chromosome segregation in Caenorhabditis elegans. PLoS Genet. 2018 14(6) e1007453
[ PubMed ID = 29879106 ]
[ RRC reference ]
|
Hong Y, Sonneville R, Wang B, Scheidt V, Meier B, Woglar A, Demetriou S, Labib K, Jantsch V, Gartner A. LEM-3 is a midbody-tethered DNA nuclease that resolves chromatin bridges during late mitosis. Nat Commun 2018 9(1) 728
[ PubMed ID = 29463814 ]
[ RRC reference ]
|
Dittrich CM, Kratz K, Sendoel A, Gruenbaum Y, Jiricny J, Hengartner MO. LEM-3 - A LEM domain containing nuclease involved in the DNA damage response in C. elegans. PLoS ONE 2012 7(2) e24555
[ PubMed ID = 22383942 ]
[ RRC reference ]
|
|