Mutants (Isolated)

tm3468

Allele Nametm3468
Sequence NameF42H11.2
CGC Namelem-3
Worm BaseAllele Name tm3468
CGC Name lem-3
Sequence F42H11.2
Phenotypehomozygous viable. Dr.M. Hengartner: increased embryonic lethality after X-irradiation.
Mutation site3525/3526-[K07A1]238/239 (330 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(1751..1880, 1931..2007, 2053..2138, 2187..2556, 2620..2703, 2747..3722, Z81097.1:106..252, Z81097.1:306..480, Z81097.1:531..684))
Map position3.81
Balancer
Map position of balancer
Sequence of primersIntFwd:CCGGTGAATATCCACGGTTC,ExtFwd:CAACGTCAGCATCCGGTGAA,ExtRev:TGCCGCCATCTGTCTGTCTG,IntRev:CATCTCCGCAGTGAAACTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hong Y, Velkova M, Silva N, Jagut M, Scheidt V, Labib K, Jantsch V, Gartner A.
The conserved LEM-3/Ankle1 nuclease is involved in the combinatorial regulation of meiotic recombination repair and chromosome segregation in Caenorhabditis elegans.
PLoS Genet. 2018 14(6) e1007453 
[ PubMed ID = 29879106 ] [ RRC reference ]

Hong Y, Sonneville R, Wang B, Scheidt V, Meier B, Woglar A, Demetriou S, Labib K, Jantsch V, Gartner A.
LEM-3 is a midbody-tethered DNA nuclease that resolves chromatin bridges during late mitosis.
Nat Commun 2018 9(1) 728 
[ PubMed ID = 29463814 ] [ RRC reference ]

Dittrich CM, Kratz K, Sendoel A, Gruenbaum Y, Jiricny J, Hengartner MO.
LEM-3 - A LEM domain containing nuclease involved in the DNA damage response in C. elegans.
PLoS ONE 2012 7(2) e24555 
[ PubMed ID = 22383942 ] [ RRC reference ]