Mutants (Isolated)

tm3464

Allele Nametm3464
Sequence NameK09C8.5
CGC Namepxn-2
Worm BaseAllele Name tm3464
CGC Name pxn-2
Sequence K09C8.5
Phenotypelethal or sterile. Dr. A. Chisholm: Emb, arrest in elongation.
Mutation site26288/26289-ACAATA-26918/26919 (630 bp deletion + 6 bp insertion)
ChromosomeX
Putative gene structurejoin(complement(Z68005.1:2469..2568, Z68005.1:2268..2422, Z68005.1:2074..2217, Z68005.1:1652..1797, Z68005.1:1494..1608, Z68005.1:1317..1441, Z68005.1:888..1272, Z68005.1:684..838, Z68005.1:431..584, Z68005.1:178..386, Z68005.1:55..124, 27354..27450, 26902..27306, 26359..26722, 26179..26296, 26026..26131, 25564..25817, 25370..25516, 23925..24102, 23593..23822, 23235..23513, 22971..23021))
Map position2.77
Balancer
Map position of balancer
Sequence of primersIntRev:GGCATTCATGCGTCTGTTAC,IntFwd:CTTGATCGGGTCTTGGCATT,ExtRev:CATCCGTGGTGGGGAGTTTC,ExtFwd:ATTAAACACGCACTGGCCAA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gotenstein JR, Koo CC, Ho TW, Chisholm AD.
Genetic Suppression of Basement Membrane Defects in Caenorhabditis elegans by Gain of Function in Extracellular Matrix and Cell-Matrix Attachment Genes.
Genetics 2018 208(4) 1499-1512 
[ PubMed ID = 29440357 ] [ RRC reference ]

Gotenstein JR, Swale RE, Fukuda T, Wu Z, Giurumescu CA, Goncharov A, Jin Y, Chisholm AD.
The C. elegans peroxidasin PXN-2 is essential for embryonic morphogenesis and inhibits adult axon regeneration.
Development 2010 137(21) 3603-13 
[ PubMed ID = 20876652 ] [ RRC reference ]

Nix P, Hammarlund M, Hauth L, Lachnit M, Jorgensen EM, Bastiani M.
Axon regeneration genes identified by RNAi screening in C. elegans.
J. Neurosci. 2014 34(2) 629-45 
[ PubMed ID = 24403161 ] [ RRC reference ]