Mutants (Isolated)

tm3433

Allele Nametm3433
Sequence NameC27A7.4
CGC Nameche-11
Worm BaseAllele Name tm3433
CGC Name che-11
Sequence C27A7.4
Phenotypehomozygous viable.
Mutation site19399/19400-19939/19940 (540 bp deletion)
ChromosomeV
Putative gene structurecomplement(join(17635..17972, 18027..18189, 18234..18446, 18489..18610, 18658..19472, 19520..19900, 19948..20056, 20103..20316, 20425..20706, 20752..20869, 20919..21184, 21231..21496, 22134..22455, 23059..23251, 23301..23422, 23470..23555, 23607..23679))
Map position3.67
Balancer
Map position of balancer
Sequence of primersExtFwd:CCAGGAAGATCTTCGTAGTA,IntFwd:CCACCCGCCATCAAGCATAA,ExtRev:GGTAGTCACTTATGACGTAC,IntRev:TGGATGGCAGTTGCTACTAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Prevo B, Mangeol P, Oswald F, Scholey JM, Peterman EJ.
Functional differentiation of cooperating kinesin-2 motors orchestrates cargo import and transport in C. elegans cilia.
Nat Cell Biol 2015 17(12) 1536-45 
[ PubMed ID = 26523365 ] [ RRC reference ]

Serwas D, Su TY, Roessler M, Wang S, Dammermann A.
Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans.
J Cell Biol 2017 216(6) 1659-1671 
[ PubMed ID = 28411189 ] [ RRC reference ]