Home > Mutants (Isolated) > tm3433

Mutants (Isolated)

Allele Name		tm3433
Sequence Name		C27A7.4
CGC Name		che-11
Worm Base	Allele Name	tm3433
	CGC Name	che-11
	Sequence	C27A7.4
Phenotype		homozygous viable.
Mutation site		19399/19400-19939/19940 (540 bp deletion)
Chromosome		V
Putative gene structure		complement(join(17635..17972, 18027..18189, 18234..18446, 18489..18610, 18658..19472, 19520..19900, 19948..20056, 20103..20316, 20425..20706, 20752..20869, 20919..21184, 21231..21496, 22134..22455, 23059..23251, 23301..23422, 23470..23555, 23607..23679))
Map position		3.67
Balancer
Map position of balancer
Sequence of primers		ExtFwd:CCAGGAAGATCTTCGTAGTA,IntFwd:CCACCCGCCATCAAGCATAA,ExtRev:GGTAGTCACTTATGACGTAC,IntRev:TGGATGGCAGTTGCTACTAC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Cevik S, Kaplan OI. Subcellular localization of the voltage-gated K+ channel EGL-36 , a member of the KV3 subfamily, in the ciliated sensory neurons in C. elegans. MicroPubl Biol 2021 2021   [ PubMed ID = 33688626 ] [ RRC reference ] Serwas D, Su TY, Roessler M, Wang S, Dammermann A. Centrioles initiate cilia assembly but are dispensable for maturation and maintenance in C. elegans. J Cell Biol 2017 216(6) 1659-1671  [ PubMed ID = 28411189 ] [ RRC reference ] Prevo B, Mangeol P, Oswald F, Scholey JM, Peterman EJ. Functional differentiation of cooperating kinesin-2 motors orchestrates cargo import and transport in C. elegans cilia. Nat Cell Biol 2015 17(12) 1536-45  [ PubMed ID = 26523365 ] [ RRC reference ]