Mutants (Isolated)

tm3425

Allele Nametm3425
Sequence NameC56C10.12
CGC Nameepg-5
Worm BaseAllele Name tm3425
CGC Name epg-5
Sequence C56C10.12
Phenotypehomozygous viable. Dr. S. McIntire: sluggish locomotion. Dr. H. Sawa: not Psa, vacuoles in the gut.
Mutation site33713/33714-34452/34453 (739 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(29155..29274, 29369..29455, 29504..29960, 30356..31552, 31600..32324, 32368..32492, 32540..32832, 32879..32955, 33005..33063, 33119..33506, 33558..33691, 33742..34345, 34392..34649, 34696..34795, 34845..34906, 34957..35070))
Map position-0.08
Balancer
Map position of balancer
Sequence of primersIntRev:TGGCGGAATTGGTTCGTCCA,ExtFwd:CGAACGCTGTGCCTGAAAGA,IntFwd:TCTAGGAGCCAAAGGATAAC,ExtRev:TCGTACTGTACTTGTCGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lu Q, Yang P, Huang X, Hu W, Guo B, Wu F, Lin L, Kovács AL, Yu L, Zhang H.
The WD40 repeat PtdIns(3)P-binding protein EPG-6 regulates progression of omegasomes to autophagosomes.
Dev. Cell 2011 21(2) 343-57 
[ PubMed ID = 21802374 ] [ RRC reference ]

Huang S, Jia K, Wang Y, Zhou Z, Levine B.
Autophagy genes function in apoptotic cell corpse clearance during C. elegans embryonic development.
Autophagy 2013 9(2) 138-49 
[ PubMed ID = 23108454 ] [ RRC reference ]

Li W, Zou W, Yang Y, Chai Y, Chen B, Cheng S, Tian D, Wang X, Vale RD, Ou G.
Autophagy genes function sequentially to promote apoptotic cell corpse degradation in the engulfing cell.
J. Cell Biol. 2012 197(1) 27-35 
[ PubMed ID = 22451698 ] [ RRC reference ]

Sun T, Wang X, Lu Q, Ren H, Zhang H.
CUP-5, the C. elegans ortholog of the mammalian lysosomal channel protein MLN1/TRPML1, is required for proteolytic degradation in autolysosomes.
Autophagy 2011 7(11) 1308-15 
[ PubMed ID = 21997367 ] [ RRC reference ]

Tian Y, Li Z, Hu W, Ren H, Tian E, Zhao Y, Lu Q, Huang X, Yang P, Li X, Wang X, Kovács AL, Yu L, Zhang H.
C. elegans screen identifies autophagy genes specific to multicellular organisms.
Cell 2010 141(6) 1042-55 
[ PubMed ID = 20550938 ] [ RRC reference ]

Cheng S, Wu Y, Lu Q, Yan J, Zhang H, Wang X.
Autophagy genes coordinate with the class II PI/PtdIns 3-kinase PIKI-1 to regulate apoptotic cell clearance in C. elegans.
Autophagy 2013 9(12) 2022-32 
[ PubMed ID = 24165672 ] [ RRC reference ]

Lin L, Yang P, Huang X, Zhang H, Lu Q, Zhang H.
The scaffold protein EPG-7 links cargo-receptor complexes with the autophagic assembly machinery.
J. Cell Biol. 2013 201(1) 113-29 
[ PubMed ID = 23530068 ] [ RRC reference ]

Wang H, Lu Q, Cheng S, Wang X, Zhang H.
Autophagy activity contributes to programmed cell death in Caenorhabditis elegans.
Autophagy 2013 9(12) 1975-82 
[ PubMed ID = 24185352 ] [ RRC reference ]

Zhang P, Zhang H.
Autophagy modulates miRNA-mediated gene silencing and selectively degrades AIN-1/GW182 in C. elegans.
EMBO Rep. 2013 14(6) 568-76 
[ PubMed ID = 23619095 ] [ RRC reference ]

Guo B, Liang Q, Li L, Hu Z, Wu F, Zhang P, Ma Y, Zhao B, Kovács AL, Zhang Z, Feng D, Chen S, Zhang H.
O-GlcNAc-modification of SNAP-29 regulates autophagosome maturation.
Nat. Cell Biol. 2014 16(12) 1215-26 
[ PubMed ID = 25419848 ] [ RRC reference ]

Chen Y, Scarcelli V, Legouis R.
Approaches for Studying Autophagy in Caenorhabditis elegans.
Cells 2017 6(3)  
[ PubMed ID = 28867808 ] [ RRC reference ]

Stavoe AK, Hill SE, Hall DH, Colón-Ramos DA.
KIF1A/UNC-104 Transports ATG-9 to Regulate Neurodevelopment and Autophagy at Synapses.
Dev. Cell 2016 38(2) 171-85 
[ PubMed ID = 27396362 ] [ RRC reference ]

Palmisano NJ, Meléndez A.
Autophagy in C. elegans development.
Dev. Biol. 2019 447(1) 103-125 
[ PubMed ID = 29709599 ] [ RRC reference ]