Mutants (Isolated)

tm3421

Allele Nametm3421
Sequence NameC43G2.2
CGC NameC43G2.2
Worm BaseAllele Name tm3421
CGC Name C43G2.2
Sequence C43G2.2
Phenotypelethal or sterile. Dr. H. Sawa: Emb.
Mutation site16775/16776-17488/17489 (713 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(14043..14491, 14985..15051, 15205..15381, 16164..16546, 17238..17481, 17535..17627, 17712..17899, 18217..18409, 18862..18999, 19384..19860, 20271..20471))
Map position3.21
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtRev:GGCCAAGAGGAGTGTTGTAG,IntRev:GGCACATGCTTTTAACGGAC,ExtFwd:GCCCTATGAGATGCAAACGT,IntFwd:ATGCAAACGTGGCAGCATCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Aguirre-Chen C, B├╝low HE, Kaprielian Z.
C. elegans bicd-1, homolog of the Drosophila dynein accessory factor Bicaudal D, regulates the branching of PVD sensory neuron dendrites.
Development 2011 138(3) 507-18 
[ PubMed ID = 21205795 ] [ RRC reference ]

Fridolfsson HN, Ly N, Meyerzon M, Starr DA.
UNC-83 coordinates kinesin-1 and dynein activities at the nuclear envelope during nuclear migration.
Dev. Biol. 2010 338(2) 237-50 
[ PubMed ID = 20005871 ] [ RRC reference ]