Mutants (Isolated)

tm342

Allele Nametm342
Sequence NameB0302.1
CGC Namesid-3
Worm BaseAllele Name tm342
CGC Name sid-3
Sequence B0302.1
Phenotypehomozygous viable
Mutation site18922/18923-ttattca-19743/19744 (821 bp deletion)
ChromosomeX
Putative gene structurejoin(18818..18967, 19013..19180, 19588..19728, 19781..19861, 19923..20111, 20182..20648, 21409..21526, 21575..21704, 21817..21931, 21977..22050, 22731..22862, 22978..23204, 23274..23420, 23463..24513, 24563..24863, 25223..25403)
Map position24.05
Balancer
Map position of balancer
Sequence of primersIntRev:TCCTAGTGGGTCTCCGTGAC,ExtFwd:CTCTGCCATTTTCAGACGTA,ExtRev:GCTGGGTTACCCCATGATTG,IntFwd:AATGGCAAGCACGTCAGGGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Tanguy M, Véron L, Stempor P, Ahringer J, Sarkies P, Miska EA.
An Alternative STAT Signaling Pathway Acts in Viral Immunity in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 28874466 ] [ RRC reference ]

Wang E, Hunter CP.
SID-1 Functions in Multiple Roles To Support Parental RNAi in Caenorhabditis elegans.
Genetics 2017 207(2) 547-557 
[ PubMed ID = 28751423 ] [ RRC reference ]

Jose AM, Kim YA, Leal-Ekman S, Hunter CP.
Conserved tyrosine kinase promotes the import of silencing RNA into Caenorhabditis elegans cells.
Proc Natl Acad Sci U S A 2012 109(36) 14520-5 
[ PubMed ID = 22912399 ] [ RRC reference ]