Mutants (Isolated)

tm342

Allele Nametm342
Allele TypeNormal
Sequence NameB0302.1
Gene Namesid-3
Worm BaseAllele Name tm342
Gene Name sid-3
Sequence B0302.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 18922/18923-ttattca-19743/19744 (821 bp deletion)
ChromosomeX
Putative gene structurejoin(18818..18967, 19013..19180, 19588..19728, 19781..19861, 19923..20111, 20182..20648, 21409..21526, 21575..21704, 21817..21931, 21977..22050, 22731..22862, 22978..23204, 23274..23420, 23463..24513, 24563..24863, 25223..25403)
Map position24.05
Balancer
Map position of balancer
Sequence of primersIntRev:TCCTAGTGGGTCTCCGTGAC,ExtFwd:CTCTGCCATTTTCAGACGTA,ExtRev:GCTGGGTTACCCCATGATTG,IntFwd:AATGGCAAGCACGTCAGGGG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dejima K, Imae R, Suehiro Y, Yoshida K, Mitani S.
An endomembrane zinc transporter negatively regulates systemic RNAi in Caenorhabditis elegans.
iScience 2023 26(6) 106930 
[ PubMed ID = 37305693 ] [ RRC reference ]

Bhatia S, Hunter CP.
SID-4/NCK-1 is important for dsRNA import in Caenorhabditis elegans.
G3 (Bethesda) 2022 12(11)  
[ PubMed ID = 36165710 ] [ RRC reference ]

Tanguy M, Véron L, Stempor P, Ahringer J, Sarkies P, Miska EA.
An Alternative STAT Signaling Pathway Acts in Viral Immunity in Caenorhabditis elegans.
mBio 2017 8(5)  
[ PubMed ID = 28874466 ] [ RRC reference ]

Wang E, Hunter CP.
SID-1 Functions in Multiple Roles To Support Parental RNAi in Caenorhabditis elegans.
Genetics 2017 207(2) 547-557 
[ PubMed ID = 28751423 ] [ RRC reference ]

Jose AM, Kim YA, Leal-Ekman S, Hunter CP.
Conserved tyrosine kinase promotes the import of silencing RNA into Caenorhabditis elegans cells.
Proc Natl Acad Sci U S A 2012 109(36) 14520-5 
[ PubMed ID = 22912399 ] [ RRC reference ]