Home > Mutants (Isolated) > tm342

Mutants (Isolated)

Allele Name		tm342
Sequence Name		B0302.1
CGC Name		sid-3
Worm Base	Allele Name	tm342
	CGC Name	sid-3
	Sequence	B0302.1
Phenotype		homozygous viable
Mutation site		18922/18923-ttattca-19743/19744 (821 bp deletion)
Chromosome		X
Putative gene structure		join(18818..18967, 19013..19180, 19588..19728, 19781..19861, 19923..20111, 20182..20648, 21409..21526, 21575..21704, 21817..21931, 21977..22050, 22731..22862, 22978..23204, 23274..23420, 23463..24513, 24563..24863, 25223..25403)
Map position		24.05
Balancer
Map position of balancer
Sequence of primers		IntRev:TCCTAGTGGGTCTCCGTGAC,ExtFwd:CTCTGCCATTTTCAGACGTA,ExtRev:GCTGGGTTACCCCATGATTG,IntFwd:AATGGCAAGCACGTCAGGGG
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Wang E, Hunter CP. SID-1 Functions in Multiple Roles To Support Parental RNAi in Caenorhabditis elegans. Genetics 2017 207(2) 547-557  [ PubMed ID = 28751423 ] [ RRC reference ] Tanguy M, Véron L, Stempor P, Ahringer J, Sarkies P, Miska EA. An Alternative STAT Signaling Pathway Acts in Viral Immunity in Caenorhabditis elegans. MBio 2017 8(5)   [ PubMed ID = 28874466 ] [ RRC reference ] Jose AM, Kim YA, Leal-Ekman S, Hunter CP. Conserved tyrosine kinase promotes the import of silencing RNA into Caenorhabditis elegans cells. Proc. Natl. Acad. Sci. U.S.A. 2012 109(36) 14520-5  [ PubMed ID = 22912399 ] [ RRC reference ]