Allele Name | tm342 |
Allele Type | Normal |
Sequence Name | B0302.1 |
Gene Name | sid-3 |
Worm Base | Allele Name |
tm342
|
Gene Name |
sid-3
|
Sequence |
B0302.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 18922/18923-ttattca-19743/19744 (821 bp deletion) |
Chromosome | X |
Putative gene structure | join(18818..18967, 19013..19180, 19588..19728, 19781..19861, 19923..20111, 20182..20648, 21409..21526, 21575..21704, 21817..21931, 21977..22050, 22731..22862, 22978..23204, 23274..23420, 23463..24513, 24563..24863, 25223..25403) |
Map position | 24.05 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:TCCTAGTGGGTCTCCGTGAC,ExtFwd:CTCTGCCATTTTCAGACGTA,ExtRev:GCTGGGTTACCCCATGATTG,IntFwd:AATGGCAAGCACGTCAGGGG |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Dejima K, Imae R, Suehiro Y, Yoshida K, Mitani S. An endomembrane zinc transporter negatively regulates systemic RNAi in Caenorhabditis elegans. iScience 2023 26(6) 106930
[ PubMed ID = 37305693 ]
[ RRC reference ]
|
Bhatia S, Hunter CP. SID-4/NCK-1 is important for dsRNA import in Caenorhabditis elegans. G3 (Bethesda) 2022 12(11)
[ PubMed ID = 36165710 ]
[ RRC reference ]
|
Tanguy M, Véron L, Stempor P, Ahringer J, Sarkies P, Miska EA. An Alternative STAT Signaling Pathway Acts in Viral Immunity in Caenorhabditis elegans. mBio 2017 8(5)
[ PubMed ID = 28874466 ]
[ RRC reference ]
|
Wang E, Hunter CP. SID-1 Functions in Multiple Roles To Support Parental RNAi in Caenorhabditis elegans. Genetics 2017 207(2) 547-557
[ PubMed ID = 28751423 ]
[ RRC reference ]
|
Jose AM, Kim YA, Leal-Ekman S, Hunter CP. Conserved tyrosine kinase promotes the import of silencing RNA into Caenorhabditis elegans cells. Proc Natl Acad Sci U S A 2012 109(36) 14520-5
[ PubMed ID = 22912399 ]
[ RRC reference ]
|
|