Mutants (Isolated)

tm3411

Allele Nametm3411
Sequence NameT19E7.2
CGC Nameskn-1
Worm BaseAllele Name tm3411
CGC Name skn-1
Sequence T19E7.2
Phenotypelethal or sterile.
Mutation site274/275-586/587 (312 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(36..112, 165..532, 686..944, 1621..1773, 1827..2148, 3455..3877)), complement(join(36..112, 165..532, 686..944, 1139..1367))
Map position2.02
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:AGGGCTTCTCAGATGTAATG,IntFwd:GGGACATCTTGTCGTGACGA,ExtRev:CATATCTTGGAATGGCAGAG,IntRev:GTTAACCTAGAAGCGGCTTA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Joshi KK, Matlack TL, Rongo C.
Dopamine signaling promotes the xenobiotic stress response and protein homeostasis.
EMBO J. 2016 35(17) 1885-901 
[ PubMed ID = 27261197 ] [ RRC reference ]

Ruf V, Holzem C, Peyman T, Walz G, Blackwell TK, Neumann-Haefelin E.
TORC2 signaling antagonizes SKN-1 to induce C. elegans mesendodermal embryonic development.
Dev. Biol. 2013 384(2) 214-27 
[ PubMed ID = 23973804 ] [ RRC reference ]

Ghose P, Park EC, Tabakin A, Salazar-Vasquez N, Rongo C.
Anoxia-reoxygenation regulates mitochondrial dynamics through the hypoxia response pathway, SKN-1/Nrf, and stomatin-like protein STL-1/SLP-2.
PLoS Genet. 2013 9(12) e1004063 
[ PubMed ID = 24385935 ] [ RRC reference ]

Dresen A, Finkbeiner S, Dottermusch M, Beume JS, Li Y, Walz G, Neumann-Haefelin E.
Caenorhabditis elegans OSM-11 signaling regulates SKN-1/Nrf during embryonic development and adult longevity and stress response.
Dev. Biol. 2015 400(1) 118-31 
[ PubMed ID = 25637691 ] [ RRC reference ]

Ewald CY, Landis JN, Porter Abate J, Murphy CT, Blackwell TK.
Dauer-independent insulin/IGF-1-signalling implicates collagen remodelling in longevity.
Nature 2015 519(7541) 97-101 
[ PubMed ID = 25517099 ] [ RRC reference ]