Mutants (Isolated)

tm3410

Allele Nametm3410
Sequence NameY32H12A.5
CGC NameY32H12A.5
Worm BaseAllele Name tm3410
CGC Name Y32H12A.5
Sequence Y32H12A.5
Phenotypehomozygous viable.
Mutation site30927/30928-GAAAAA-31699/31700 (772 bp deletion + 6 bp insertion)
ChromosomeIII
Putative gene structurecomplement(join(29959..30183, 30397..31131, 31540..31907, 32590..32729, 32778..32881, 33414..33503, 33581..33664))
Map position-1.79
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGGAGATCGCGTGATAATG,IntFwd:AGCGGCGAGCACGACAAATG,ExtRev:CCCTCCTTTCACTAAACTAC,IntRev:GGAGATGTCCCATCAACGTC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ruiz M, Bodhicharla R, Ståhlman M, Svensk E, Busayavalasa K, Palmgren H, Ruhanen H, Boren J, Pilon M.
Evolutionarily conserved long-chain Acyl-CoA synthetases regulate membrane composition and fluidity.
Elife 2019 8  
[ PubMed ID = 31769755 ] [ RRC reference ]

Chen YL, Tao J, Zhao PJ, Tang W, Xu JP, Zhang KQ, Zou CG.
Adiponectin receptor PAQR-2 signaling senses low temperature to promote C. elegans longevity by regulating autophagy.
Nat Commun 2019 10(1) 2602 
[ PubMed ID = 31197136 ] [ RRC reference ]

Ruiz M, Bodhicharla R, Svensk E, Devkota R, Busayavalasa K, Palmgren H, Ståhlman M, Boren J, Pilon M.
Membrane fluidity is regulated by the C. elegans transmembrane protein FLD-1 and its human homologs TLCD1/2.
Elife 2018 7  
[ PubMed ID = 30509349 ] [ RRC reference ]

Bodhicharla R, Devkota R, Ruiz M, Pilon M.
Membrane Fluidity Is Regulated Cell Nonautonomously by Caenorhabditiselegans PAQR-2 and Its Mammalian Homolog AdipoR2.
Genetics 2018 210(1) 189-201 
[ PubMed ID = 29997234 ] [ RRC reference ]

Svensk E, Biermann J, Hammarsten S, Magnusson F, Pilon M.
Leveraging the withered tail tip phenotype in C. elegans to identify proteins that influence membrane properties.
Worm 2016 5(3) e1206171 
[ PubMed ID = 27695656 ] [ RRC reference ]

Lee D, An SWA, Jung Y, Yamaoka Y, Ryu Y, Goh GYS, Beigi A, Yang JS, Jung GY, Ma DK, Ha CM, Taubert S, Lee Y, Lee SV.
MDT-15/MED15 permits longevity at low temperature via enhancing lipidostasis and proteostasis.
PLoS Biol 2019 17(8) e3000415 
[ PubMed ID = 31408455 ] [ RRC reference ]

Kyriakakis E, Charmpilas N, Tavernarakis N.
Differential adiponectin signalling couples ER stress with lipid metabolism to modulate ageing in C. elegans.
Sci Rep 2017 7(1) 5115 
[ PubMed ID = 28698593 ] [ RRC reference ]

Svensk E, Devkota R, Ståhlman M, Ranji P, Rauthan M, Magnusson F, Hammarsten S, Johansson M, Borén J, Pilon M.
Caenorhabditis elegans PAQR-2 and IGLR-2 Protect against Glucose Toxicity by Modulating Membrane Lipid Composition.
PLoS Genet 2016 12(4) e1005982 
[ PubMed ID = 27082444 ] [ RRC reference ]

Lee D, Jeong DE, Son HG, Yamaoka Y, Kim H, Seo K, Khan AA, Roh TY, Moon DW, Lee Y, Lee SJ.
SREBP and MDT-15 protect C. elegans from glucose-induced accelerated aging by preventing accumulation of saturated fat.
Genes Dev 2015 29(23) 2490-503 
[ PubMed ID = 26637528 ] [ RRC reference ]

Svensson E, Olsen L, Mörck C, Brackmann C, Enejder A, Faergeman NJ, Pilon M.
The adiponectin receptor homologs in C. elegans promote energy utilization and homeostasis.
PLoS One 2011 6(6) e21343 
[ PubMed ID = 21712952 ] [ RRC reference ]

Svensk E, Ståhlman M, Andersson CH, Johansson M, Borén J, Pilon M.
PAQR-2 regulates fatty acid desaturation during cold adaptation in C. elegans.
PLoS Genet 2013 9(9) e1003801 
[ PubMed ID = 24068966 ] [ RRC reference ]