Mutants (Isolated)

tm3395

Allele Nametm3395
Sequence NameC18E3.2
CGC NameC18E3.2
Worm BaseAllele Name tm3395
CGC Name C18E3.2
Sequence C18E3.2
Phenotypelethal or sterile.
Mutation site26234/26235-TT-26655/26656 (421 bp deletion + 2 bp insertion)
ChromosomeI
Putative gene structurejoin(25966..26016, 26085..26228, 26276..27360, 27412..27481)
Map position-1.59
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersIntRev:CCCCATCCCTGAGCATTTAA,IntFwd:ATGGGCCTCGAATGGTTGCA,ExtRev:AATCTCAACCCCCATCCCTG,ExtFwd:CGGGAGGTTTTGCTGGTCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Ertl I, Porta-de-la-Riva M, Gómez-Orte E, Rubio-Peña K, Aristizábal-Corrales D, Cornes E, Fontrodona L, Osteikoetxea X, Ayuso C, Askjaer P, Cabello J, Cerón J.
Functional Interplay of Two Paralogs Encoding SWI/SNF Chromatin-Remodeling Accessory Subunits During Caenorhabditis elegans Development.
Genetics 2016 202(3) 961-75 
[ PubMed ID = 26739451 ] [ RRC reference ]

Mathies LD, Blackwell GG, Austin MK, Edwards AC, Riley BP, Davies AG, Bettinger JC.
SWI/SNF chromatin remodeling regulates alcohol response behaviors in Caenorhabditis elegans and is associated with alcohol dependence in humans.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(10) 3032-7 
[ PubMed ID = 25713357 ] [ RRC reference ]

Large EE, Mathies LD.
Caenorhabditis elegans SWI/SNF subunits control sequential developmental stages in the somatic gonad.
G3 (Bethesda) 2014 4(3) 471-83 
[ PubMed ID = 24402584 ] [ RRC reference ]