Home > Mutants (Isolated) > tm3394

Mutants (Isolated)

Allele Name		tm3394
Allele Type		Normal
Sequence Name		R12E2.9
Gene Name		inx-15
Worm Base	Allele Name	tm3394
	Gene Name	inx-15
	Sequence	R12E2.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. C.P. Hunter: no growth or fertility defects at 20C. Dr. C-F. Chuang: normal AWC signaling.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		12762/12763-13220/13221 (458 bp deletion)
Chromosome		I
Putative gene structure		complement(join(11504..11641, 11688..11966, 12019..12092, 12592..13120, 13389..13517))
Map position		-1.65
Balancer
Map position of balancer
Sequence of primers		ExtRev:TTCCTCTTGGCATACCAGAG,IntRev:TACCAGAGACACTCTCCCTC,ExtFwd:CTGGCTAGTTATATCCCCCA,IntFwd:CCCCCAGCTTCAGATTAATC
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Zhang X, Wang Y, Cai Z, Wan Z, Aihemaiti Y, Tu H. A gonadal gap junction INX-14/Notch GLP-1 signaling axis suppresses gut defense through an intestinal lysosome pathway. Front Immunol 2023 14 1249436  [ PubMed ID = 37928537 ] [ RRC reference ] Jang H, Levy S, Flavell SW, Mende F, Latham R, Zimmer M, Bargmann CI. Dissection of neuronal gap junction circuits that regulate social behavior in Caenorhabditis elegans. Proc Natl Acad Sci U S A 2017 114(7) E1263-E1272  [ PubMed ID = 28143932 ] [ RRC reference ] Liu P, Chen B, Altun ZF, Gross MJ, Shan A, Schuman B, Hall DH, Wang ZW. Six innexins contribute to electrical coupling of C. elegans body-wall muscle. PLoS One 2013 8(10) e76877  [ PubMed ID = 24130800 ] [ RRC reference ]