Home > Mutants (Isolated) > tm338

Mutants (Isolated)

Allele Name		tm338
Allele Type		Normal
Sequence Name		ZK622.5
Gene Name		ZK622.5
Worm Base	Allele Name	tm338
	Gene Name	ZK622.5
	Sequence	ZK622.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		13414/13415-13908/13909 (494 bp deletion)
Chromosome		II
Putative gene structure		join(12646..12885, 12977..13080, 13126..13227, 13282..13384)
Map position		-1.8
Balancer
Map position of balancer
Sequence of primers		IntRev:CGATGTGGAATTGGATCATG,ExtRev:CCTTTCGTTTTTGGCGAGAA,ExtFwd:ACACGACGAGTTCATGGGAT,IntFwd:CGAGTCTGTATTTGTGTACC
Distributed lab
Depositor		Dr. S. Mitani
References		Please submit your publication Marsac R, Pinson B, Saint-Marc C, Olmedo M, Artal-Sanz M, Daignan-Fornier B, Gomes JE. Purine Homeostasis Is Necessary for Developmental Timing, Germline Maintenance and Muscle Integrity in Caenorhabditis elegans. Genetics 2019 211(4) 1297-1313  [ PubMed ID = 30700528 ] [ RRC reference ] Ouellet J, Li S, Roy R. Notch signalling is required for both dauer maintenance and recovery in C. elegans. Development 2008 135(15) 2583-92  [ PubMed ID = 18599512 ] [ RRC reference ]