Mutants (Isolated)

tm338

Allele Nametm338
Sequence NameZK622.5
CGC NameZK622.5
Worm BaseAllele Name tm338
CGC Name ZK622.5
Sequence ZK622.5
Phenotypehomozygous viable
Mutation site13414/13415-13908/13909 (494 bp deletion)
ChromosomeII
Putative gene structurejoin(12646..12885, 12977..13080, 13126..13227, 13282..13384)
Map position-1.8
Balancer
Map position of balancer
Sequence of primersIntRev:CGATGTGGAATTGGATCATG,ExtRev:CCTTTCGTTTTTGGCGAGAA,ExtFwd:ACACGACGAGTTCATGGGAT,IntFwd:CGAGTCTGTATTTGTGTACC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ouellet J, Li S, Roy R.
Notch signalling is required for both dauer maintenance and recovery in C. elegans.
Development 2008 135(15) 2583-92 
[ PubMed ID = 18599512 ] [ RRC reference ]