Mutants (Isolated)

tm3378

Allele Nametm3378
Sequence NameF02H6.5
CGC NameF02H6.5
Worm BaseAllele Name tm3378
CGC Name F02H6.5
Sequence F02H6.5
Phenotypehomozygous viable.
Mutation site24349/24350-24794/24795 (445 bp deletion)
ChromosomeIV
Putative gene structurejoin(23025..23049, 23971..24308, 24582..24680, 25326..25619, 25786..25956, 26121..26228, 26539..26682, 27113..27349)
Map position11.6
Balancer
Map position of balancer
Sequence of primersIntRev:CCGCGGATTTCTAGATATAG,ExtRev:ACAGTGCATTTCCACCCTGA,IntFwd:CCATGATGGAAGCCCGGAAT,ExtFwd:CGGAGAGAGCGATAGAATCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Horsman JW, Heinis FI, Miller DL.
A Novel Mechanism To Prevent H2S Toxicity in Caenorhabditis elegans.
Genetics 2019 213(2) 481-490 
[ PubMed ID = 31371406 ] [ RRC reference ]

Romanelli-Credrez L, Doitsidou M, Alkema MJ, Salinas G.
HIF-1 Has a Central Role in Caenorhabditis elegans Organismal Response to Selenium.
Front Genet 2020 11 63 
[ PubMed ID = 32161616 ] [ RRC reference ]

Horsman JW, Miller DL.
Mitochondrial Sulfide Quinone Oxidoreductase Prevents Activation of the Unfolded Protein Response in Hydrogen Sulfide.
J Biol Chem 2016 291(10) 5320-5 
[ PubMed ID = 26677221 ] [ RRC reference ]

Budde MW, Roth MB.
The response of Caenorhabditis elegans to hydrogen sulfide and hydrogen cyanide.
Genetics 2011 189(2) 521-32 
[ PubMed ID = 21840852 ] [ RRC reference ]