Mutants (Isolated)

tm336

Allele Nametm336
Sequence NameT08G11.2
CGC NameT08G11.2
Worm BaseAllele Name tm336
CGC Name T08G11.2
Sequence T08G11.2
Phenotypehomozygous viable
Mutation site22530/22531-23558/23559 (1028 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(23311..23379,23431..23716,23766..23843, 23890..24254, 24337..24387))
Map position3.22
Balancer
Map position of balancer
Sequence of primersIntRev:CGACCTGATCAGTCATTTAC,IntFwd:GTTTGTGGCAATAGGAACGA,ExtFwd:GAGTGAATCGAACCTGGTGT,ExtRev:CCGCATTGACAAATCTGACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
McGovern M, Yu L, Kosinski M, Greenstein D, Savage-Dunn C.
A role for sperm in regulation of egg-laying in the nematode C. elegans.
BMC Dev Biol 2007 7 41 
[ PubMed ID = 17472754 ] [ RRC reference ]