Mutants (Isolated)

tm3357

Allele Nametm3357
Sequence NameT04C10.2a
CGC Nameepn-1
Worm BaseAllele Name tm3357
CGC Name epn-1
Sequence T04C10.2a
Phenotypelethal or sterile.
Mutation site8675/8676-ATATATC-9004/9005 (329 bp deletion + 7 bp insertion)
ChromosomeX
Putative gene structurecomplement(join(7729..7907, 8139..8289, 8342..8728, 8778..8935, 9013..9274, 9325..9677, 9753..9785, 9836..10115))
Map position21.39
Balancer
Map position of balancer
Sequence of primersIntRev:GCGGCCACGAGAAGGTAATG,ExtRev:CGACACGTGTACAAAAGTCT,IntFwd:GGTTGTACTGACCTGTGGTG,ExtFwd:GTAAAGGTGTGAGCACGAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Kang YL, Yochem J, Bell L, Sorensen EB, Chen L, Conner SD.
Caenorhabditis elegans reveals a FxNPxY-independent low-density lipoprotein receptor internalization mechanism mediated by epsin1.
Mol. Biol. Cell 2013 24(3) 308-18 
[ PubMed ID = 23242996 ] [ RRC reference ]

Shen Q, He B, Lu N, Conradt B, Grant BD, Zhou Z.
Phagocytic receptor signaling regulates clathrin and epsin-mediated cytoskeletal remodeling during apoptotic cell engulfment in C. elegans.
Development 2013 140(15) 3230-43 
[ PubMed ID = 23861060 ] [ RRC reference ]