Mutants (Isolated)

tm334

Allele Nametm334
Sequence NameB0244.2
CGC Nameida-1
Worm BaseAllele Name tm334
CGC Name ida-1
Sequence B0244.2
Phenotypehomozygous viable. Dr. M. Krause: J. Neurosci.24, 3115-3124 (2004). Dr. C. Bargmann & Dr. K. Shen: HSN presynaptic vesicle localization normal.
Mutation site35553/35554-TCGA-36087/36088 (534 bp deletion plus short insertion)
ChromosomeIII
Putative gene structurejoin(34661..34721, 34932..35091, 35271..35554,35950..36054, 36551..36568, 36654..36724, 36804..37112, 37495..37630, 37771..37861, 37907..38144, 38233..38512, 39020..39111)
Map position-1.44
Balancer
Map position of balancer
Sequence of primersIntRev:GCTCTTAGCACTCGTTGGTG,ExtRev:CTTTACGACGGAACTCCAAA,ExtFwd:TTGATGGCTGTGCCACCGGT,IntFwd:GCATCAAAAGCATCCACAGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cai T, Fukushige T, Notkins AL, Krause M.
Insulinoma-Associated Protein IA-2, a Vesicle Transmembrane Protein, Genetically Interacts with UNC-31/CAPS and Affects Neurosecretion in Caenorhabditis elegans.
J. Neurosci. 2004 24(12) 3115-24 
[ PubMed ID = 15044551 ] [ RRC reference ]

Huang H, Zhu Y, Eliot MN, Knopik VS, McGeary JE, Carskadon MA, Hart AC.
Combining Human Epigenetics and Sleep Studies in Caenorhabditis elegans: A Cross-Species Approach for Finding Conserved Genes Regulating Sleep.
Sleep 2017 40(6)  
[ PubMed ID = 28431118 ] [ RRC reference ]