Mutants (Isolated)

tm3335

Allele Nametm3335
Sequence NameR05F9.1
CGC NameR05F9.1
Worm BaseAllele Name tm3335
CGC Name R05F9.1
Sequence R05F9.1
Phenotypehomozygous viable.
Mutation site25508/25509-TACTG-25805/25806 (297 bp deletion + 5 bp insertion)
ChromosomeII
Putative gene structurejoin(20602..20752, 20811..20929, 21400..21466, 24351..24485, 24875..24978, 25060..25959, 26289..26516, 26899..26961)
Map position-2.92
Balancer
Map position of balancer
Sequence of primersExtRev:CGGGAACCAAACCTAGCTAA,IntFwd:TCAATGTCACTTGGAGGTCC,IntRev:TGACGCGAACTAAACTACCA,ExtFwd:TCAGGACGGTCATTATCGTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nawa M, Kage-Nakadai E, Aiso S, Okamoto K, Mitani S, Matsuoka M.
Reduced expression of BTBD10, an Akt activator, leads to motor neuron death.
Cell Death Differ. 2012 19(8) 1398-407 
[ PubMed ID = 22388351 ] [ RRC reference ]