Mutants (Isolated)

tm3334

Allele Nametm3334
Sequence NameF09E10.8
CGC Nametoca-1
Worm BaseAllele Name tm3334
CGC Name toca-1
Sequence F09E10.8
Phenotypehomozygous viable. Dr. K. Oegema: wt dyf.
Mutation site27325/27326-28479/28480 (1154 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(24644..24713, 24843..25000, 25737..26353, 27287..27597, 28200..28484, 29314..29429, 34938..34970))
Map position-17.93
Balancer
Map position of balancer
Sequence of primersExtFwd:AGTGGGATCCTTCCCCTGTG,IntFwd:TGTGCCGGGATTCCCTGATC,ExtRev:ACAGGAATGTACCTACCTAG,IntRev:GTACCTACCTAGGAATCCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yang Q, Roiz D, Mereu L, Daube M, Hajnal A.
The Invading Anchor Cell Induces Lateral Membrane Constriction during Vulval Lumen Morphogenesis in C. elegans.
Dev. Cell 2017 42(3) 271-285.e3 
[ PubMed ID = 28787593 ] [ RRC reference ]

Giuliani C, Troglio F, Bai Z, Patel FB, Zucconi A, Malabarba MG, Disanza A, Stradal TB, Cassata G, Confalonieri S, Hardin JD, Soto MC, Grant BD, Scita G.
Requirements for F-BAR proteins TOCA-1 and TOCA-2 in actin dynamics and membrane trafficking during Caenorhabditis elegans oocyte growth and embryonic epidermal morphogenesis.
PLoS Genet. 2009 5(10) e1000675 
[ PubMed ID = 19798448 ] [ RRC reference ]

Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20 
[ PubMed ID = 24149939 ] [ RRC reference ]