Mutants (Isolated)

tm3331

Allele Nametm3331
Sequence NameC09E8.3
CGC Namemlt-10
Worm BaseAllele Name tm3331
CGC Name mlt-10
Sequence C09E8.3
Phenotypehomozygous viable.
Mutation site5751/5752-TTTGGC-5943/5944 (192 bp deletion + 6 bp insertion)
ChromosomeII
Putative gene structurejoin(4391..4430, 4489..4562, 5281..5952, 6563..6775, 7128..7269, 7327..7424, 7902..8137, 8855..9452)
Map position-15.59
Balancer
Map position of balancer
Sequence of primersIntRev:GGTGTGATACTGAGTCGCTA,ExtFwd:CCCTGGGCTGAGGATTACTG,ExtRev:TTTGCTCAGGAGACAGATAG,IntFwd:ACCTAGTCAAATTTGCGGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Meli VS, Osuna B, Ruvkun G, Frand AR.
MLT-10 defines a family of DUF644 and proline-rich repeat proteins involved in the molting cycle of Caenorhabditis elegans.
Mol Biol Cell 2010 21(10) 1648-61 
[ PubMed ID = 20335506 ] [ RRC reference ]