Mutants (Isolated)

tm3322

Allele Nametm3322
Sequence NameC24H12.5
CGC NameC24H12.5
Worm BaseAllele Name tm3322
CGC Name C24H12.5
Sequence C24H12.5
Phenotypehomozygous viable.
Mutation site4612/4613-4930/4931 (318 bp deletion)
ChromosomeII
Putative gene structurecomplement(join(353..523, 581..676, 728..920, 1865..2156, 3109..3568, 4277..4546, 4602..4701, 4751..4830, 4875..5045))
Map position-15.61
Balancer
Map position of balancer
Sequence of primersExtFwd:GTAGATTTCGACCCACCTCA,ExtRev:CAGTCTCCCTTTGCGCGCAA,IntFwd:CCCACCTCATAGCCATTAAG,IntRev:CGCAAGCATTCGCGCTCTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]